ID: 951016928

View in Genome Browser
Species Human (GRCh38)
Location 3:17742218-17742240
Sequence CACCCCCGACGCCGACTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951016913_951016928 20 Left 951016913 3:17742175-17742197 CCCTGCCCGCCAGGGAGCTGAAG 0: 1
1: 0
2: 2
3: 13
4: 217
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016920_951016928 -6 Left 951016920 3:17742201-17742223 CCACCCCTCCCGCCATCCACCCC 0: 1
1: 0
2: 13
3: 258
4: 3876
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016912_951016928 23 Left 951016912 3:17742172-17742194 CCGCCCTGCCCGCCAGGGAGCTG 0: 1
1: 0
2: 4
3: 45
4: 884
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016911_951016928 24 Left 951016911 3:17742171-17742193 CCCGCCCTGCCCGCCAGGGAGCT 0: 1
1: 0
2: 5
3: 49
4: 518
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016919_951016928 11 Left 951016919 3:17742184-17742206 CCAGGGAGCTGAAGGGTCCACCC 0: 1
1: 0
2: 1
3: 17
4: 278
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016922_951016928 -10 Left 951016922 3:17742205-17742227 CCCTCCCGCCATCCACCCCCGAC 0: 1
1: 0
2: 3
3: 42
4: 522
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016914_951016928 19 Left 951016914 3:17742176-17742198 CCTGCCCGCCAGGGAGCTGAAGG 0: 1
1: 1
2: 0
3: 21
4: 325
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016917_951016928 15 Left 951016917 3:17742180-17742202 CCCGCCAGGGAGCTGAAGGGTCC 0: 1
1: 0
2: 3
3: 19
4: 195
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016918_951016928 14 Left 951016918 3:17742181-17742203 CCGCCAGGGAGCTGAAGGGTCCA 0: 1
1: 0
2: 0
3: 14
4: 186
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016909_951016928 28 Left 951016909 3:17742167-17742189 CCTGCCCGCCCTGCCCGCCAGGG 0: 1
1: 2
2: 10
3: 121
4: 840
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016921_951016928 -9 Left 951016921 3:17742204-17742226 CCCCTCCCGCCATCCACCCCCGA 0: 1
1: 0
2: 1
3: 38
4: 609
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88
951016907_951016928 29 Left 951016907 3:17742166-17742188 CCCTGCCCGCCCTGCCCGCCAGG 0: 1
1: 1
2: 6
3: 58
4: 555
Right 951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951016928 Original CRISPR CACCCCCGACGCCGACTCCG AGG Intronic
901031882 1:6311883-6311905 CACCCCTCACCCCGACTCCCAGG + Intronic
901137852 1:7009325-7009347 CACCCACGATGCCGCCTCTGGGG - Intronic
903875860 1:26472671-26472693 CACCGCCGCCGCCGCCTCCCTGG + Intronic
910207142 1:84759406-84759428 CAGCCCCGACGCCCACTCCTCGG + Intergenic
914902361 1:151717488-151717510 CGCCCGCGGCGCCGCCTCCGCGG - Intronic
916256226 1:162790603-162790625 CTCACCCGACGCCGTCTCCGAGG + Intergenic
917222634 1:172748317-172748339 CACCCGCGCGGCAGACTCCGCGG - Intergenic
923007904 1:230067038-230067060 GACCCCCCTCGCCGCCTCCGAGG + Intronic
923188332 1:231595901-231595923 CACCCCCGACTCCCAGTCCCTGG - Intronic
1065425432 10:25598232-25598254 CACCAACGGCACCGACTCCGTGG - Exonic
1066722691 10:38356257-38356279 CTCACCCGACGCCGTCTCCGAGG + Intergenic
1073012690 10:100373590-100373612 GAGCCCCGAGGCCGACTCCCCGG - Intergenic
1073099604 10:100999792-100999814 CAGCCCCGCCTCCGCCTCCGCGG - Exonic
1076750136 10:132538209-132538231 AACCCCCGACCCTGACCCCGGGG + Intronic
1076798094 10:132808533-132808555 CAGCCCCGACGCAGACCCCATGG + Exonic
1077891220 11:6419273-6419295 CACCCCTGCAGCCGACTCCCTGG + Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1086888194 11:92226598-92226620 CGCCCCCGACGTCCATTCCGGGG - Intergenic
1090709527 11:129373200-129373222 CACCCGCAGCGCCGACTACGAGG - Intergenic
1091335600 11:134763239-134763261 CACCACCGCCGCCGGCTCCCAGG - Intergenic
1091588092 12:1827485-1827507 CACCACCGACGCCCACGCAGAGG - Exonic
1096838872 12:54369308-54369330 CTCCCCCACCCCCGACTCCGTGG - Exonic
1100031279 12:90195049-90195071 CACCCCCCACTCCCACTCCCTGG + Intergenic
1103800452 12:123534038-123534060 CCCCCCAAGCGCCGACTCCGCGG + Intergenic
1104990084 12:132619870-132619892 CCTCTCCGACGCCGACTGCGTGG + Exonic
1108221048 13:48233447-48233469 CCCCCCCGACGCCGTCGCGGTGG + Exonic
1108685428 13:52815337-52815359 CACCCCCGCCGCCGGCTCCTGGG - Intergenic
1110596583 13:77326730-77326752 CTCCCCCGCCGCCGCCTCCTCGG - Intronic
1114477847 14:23010264-23010286 CCCCCCCGCCCCCAACTCCGGGG - Intergenic
1122885444 14:104708464-104708486 CAGCCCCGACGCCGAGGCTGTGG + Exonic
1127973498 15:63980283-63980305 CATCCCCGCCACCGACTCCTAGG + Intronic
1129710699 15:77819130-77819152 CACCCCCGCCGCTGCCCCCGAGG + Intronic
1132051483 15:98611201-98611223 CACCCCAGACGCCTACCCAGGGG + Intergenic
1132604014 16:786099-786121 CACCCCCGACCCTGACCCCGAGG - Exonic
1133784517 16:8963816-8963838 GAGCCCCGACGACGACGCCGAGG - Intronic
1134441667 16:14302517-14302539 CACCGCCGCTGCCGCCTCCGGGG - Intergenic
1139504817 16:67393562-67393584 CACCCCCGAGGCTGTCTCGGCGG + Intergenic
1139505177 16:67394997-67395019 CTCACCCGACGCCGGATCCGAGG + Exonic
1141079180 16:81035878-81035900 CGCCGCCGCCGCCGCCTCCGAGG - Exonic
1143067810 17:4263716-4263738 CTCCCGCGATGCCGACCCCGCGG - Exonic
1147587552 17:41661037-41661059 CACCCCCCACCCCCACTCCAGGG + Intergenic
1147912314 17:43862968-43862990 CACCCCCGACCCCTTCTCCAGGG - Exonic
1148124614 17:45230333-45230355 CACCCCCCACACCGCCTCCCTGG - Intronic
1148554582 17:48570637-48570659 AACCTCCGAGGCCGACACCGGGG - Intronic
1149598729 17:57879610-57879632 CTCCCCCGACTCCGCCTCCCCGG - Exonic
1152520196 17:80851600-80851622 GACCTCCGACGCCGACTCCCAGG + Intronic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1161266494 19:3366898-3366920 CACCCCCAACCCCGACTCTCGGG + Intronic
1161949911 19:7462253-7462275 CAGCCCCGAGGCCTATTCCGTGG + Exonic
1162032874 19:7925004-7925026 CACCCCCGACTCTGAATCCCGGG - Exonic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167266563 19:48485668-48485690 CACCGCAGACGCCGCCTCTGGGG - Exonic
1168280891 19:55304820-55304842 CTCCCCCGACGCCACCGCCGGGG - Exonic
1168290490 19:55354849-55354871 CTCCCCCGACGCCCCCTCGGGGG + Exonic
1168332623 19:55579046-55579068 CTCCTCCGACTCCGACTCCCGGG + Exonic
1168707995 19:58480523-58480545 CACCCCCGACGCTCACTCACAGG + Exonic
925725223 2:6865438-6865460 GACCCCGGACGCCGGCTGCGGGG - Exonic
933726292 2:85429523-85429545 CACCCCCGTGGCCGAGTCCTGGG - Intronic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
934993151 2:98935760-98935782 CACCCCCGCCGCCGAAGCCCTGG - Intronic
935622937 2:105144393-105144415 CACCCCCTCCCCCGACCCCGCGG - Intergenic
937360721 2:121228029-121228051 CACCCCAGGGGCCGGCTCCGCGG + Intronic
940007707 2:149023318-149023340 CACCCCGGAGGCCGAGTCGGTGG - Exonic
942305152 2:174599936-174599958 CACCCCCTGCCCCCACTCCGTGG - Intronic
944675927 2:202034181-202034203 CGCCCCGGCCGCCGCCTCCGCGG - Intergenic
947605737 2:231484028-231484050 CACCCCAGAGGCAGCCTCCGCGG - Intergenic
948496148 2:238351151-238351173 CACACTCGACGCCCACTCCCAGG - Intronic
948761005 2:240191040-240191062 GACCCCCGCCGCCGACTTTGGGG - Intergenic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1169478071 20:5950327-5950349 CATCCGCGACGGCGACTTCGTGG - Exonic
1173210737 20:41029463-41029485 TGCCCCCTGCGCCGACTCCGGGG + Intronic
1180137844 21:45872628-45872650 CAGCCCCAACGCGGGCTCCGGGG - Intronic
1181160570 22:20957493-20957515 CATCTCCAGCGCCGACTCCGGGG + Intergenic
1184465954 22:44668957-44668979 CGCGCGCGACGCCGACTGCGGGG + Intronic
950007992 3:9703885-9703907 CGCCGCCGCCGCCGACACCGCGG + Exonic
951016928 3:17742218-17742240 CACCCCCGACGCCGACTCCGAGG + Intronic
953055339 3:39383468-39383490 CACCCGCGCCGCAGACTCCGCGG - Exonic
956872370 3:73430678-73430700 CACCCCCAACTCCCACTCCCTGG + Intronic
968107899 3:196015314-196015336 CACCCCCCACACCAAGTCCGTGG + Intergenic
970896685 4:21111704-21111726 CACCCCTGACCCCTACTCCAAGG - Intronic
975985957 4:80202065-80202087 CACCGCCGCCGCCGCCCCCGTGG - Exonic
976600712 4:86935286-86935308 GGCCCCCGACGCCGCCGCCGCGG + Intronic
990607147 5:57422572-57422594 CTCCCCCGCCGCCGACACCGCGG - Intergenic
1006891594 6:37433523-37433545 CACCCCCAACGCCGGCTCCCTGG + Intronic
1007902048 6:45422034-45422056 CTCCCGCGCCGCCGCCTCCGCGG - Intronic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1012929562 6:105302836-105302858 CGCCCCCGCCGCCTGCTCCGAGG + Intronic
1014649449 6:124017772-124017794 CACCCCCCACCCCGACCCCCCGG + Intronic
1017163856 6:151390528-151390550 CACCCCCGCCCCCGGCGCCGGGG - Intronic
1019379239 7:712554-712576 CACCCCCAACGCCGCCCGCGCGG + Intronic
1020210265 7:6153813-6153835 CAGCCCCGCCGCCGAATCCCTGG + Exonic
1026225272 7:68434733-68434755 CACCCCCAACCCCCAGTCCGTGG - Intergenic
1027121895 7:75527901-75527923 CCCCAGCGCCGCCGACTCCGGGG + Intergenic
1039996843 8:42541627-42541649 CGCGCCCGGCCCCGACTCCGGGG + Intronic
1042643162 8:70956786-70956808 CACTCCCGACACCCACTCTGGGG - Intergenic
1049577987 8:143398380-143398402 CTCCCCCAACCCAGACTCCGGGG + Intergenic
1061231819 9:129319895-129319917 CTCCCCCGACGCCGGCCCCAGGG + Intergenic
1187900946 X:24025864-24025886 CAGCCCCGACGGCGGCGCCGCGG - Intronic
1195256332 X:103094349-103094371 CACCCCCACCCCCGCCTCCGTGG + Intergenic