ID: 951016949

View in Genome Browser
Species Human (GRCh38)
Location 3:17742275-17742297
Sequence GCCTGAGGGTGCCGCCGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951016949_951016953 -5 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016953 3:17742293-17742315 CAGGCCCTCCCGTGAGAAGGCGG 0: 1
1: 0
2: 0
3: 13
4: 161
951016949_951016963 28 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016963 3:17742326-17742348 GGCTGCAGCAGCGGCGCGAAGGG 0: 1
1: 0
2: 0
3: 14
4: 176
951016949_951016962 27 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016962 3:17742325-17742347 CGGCTGCAGCAGCGGCGCGAAGG 0: 1
1: 0
2: 2
3: 36
4: 229
951016949_951016952 -8 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016952 3:17742290-17742312 CCTCAGGCCCTCCCGTGAGAAGG 0: 1
1: 0
2: 2
3: 20
4: 188
951016949_951016954 -2 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016954 3:17742296-17742318 GCCCTCCCGTGAGAAGGCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 118
951016949_951016965 30 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016965 3:17742328-17742350 CTGCAGCAGCGGCGCGAAGGGGG 0: 1
1: 0
2: 2
3: 10
4: 172
951016949_951016964 29 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016964 3:17742327-17742349 GCTGCAGCAGCGGCGCGAAGGGG 0: 1
1: 0
2: 2
3: 19
4: 205
951016949_951016960 7 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016960 3:17742305-17742327 TGAGAAGGCGGCGGCGGCTGCGG 0: 1
1: 8
2: 18
3: 134
4: 907
951016949_951016957 1 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016957 3:17742299-17742321 CTCCCGTGAGAAGGCGGCGGCGG 0: 1
1: 0
2: 3
3: 12
4: 141
951016949_951016961 19 Left 951016949 3:17742275-17742297 CCGTGGCGGCGGCACCCTCAGGC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 951016961 3:17742317-17742339 GGCGGCTGCGGCTGCAGCAGCGG 0: 1
1: 5
2: 65
3: 482
4: 2668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951016949 Original CRISPR GCCTGAGGGTGCCGCCGCCA CGG (reversed) Intronic
900131874 1:1090688-1090710 GCCTGCGGGTGCCGCCTCCTGGG - Intronic
900374111 1:2345507-2345529 GCCTGAGGGTCCGGCTGGCAGGG - Intronic
900473852 1:2867262-2867284 GTCCGAGGGTGCGGCCACCAAGG + Intergenic
900481199 1:2900226-2900248 AGCTGAGGGTCCTGCCGCCATGG - Intergenic
900610636 1:3543168-3543190 GCCTCAGGGTGCCCCGGCCCTGG - Intronic
901298928 1:8184114-8184136 GCCTGAGGGTGCGGCTGTCTCGG + Intergenic
903656940 1:24955267-24955289 GCCTGAGGGCACCACCTCCATGG - Intronic
904041686 1:27589055-27589077 TGCTGAGGGTGCAGCTGCCATGG + Intronic
905542837 1:38773854-38773876 ACCTTAGGGTGCTGCCCCCAGGG - Intergenic
905731451 1:40301712-40301734 GGCTGAGCGTGAGGCCGCCATGG + Intronic
905731757 1:40303251-40303273 GGCTGAGCGTGAGGCCGCCATGG + Intronic
906460340 1:46031425-46031447 GGCTGAGGGAGCCACAGCCAAGG + Exonic
910251096 1:85200574-85200596 GCCGGTGGGTGCAGCCGCCCGGG + Exonic
917755477 1:178094048-178094070 GCTTGGGGGCGTCGCCGCCAGGG - Intergenic
1062916916 10:1247746-1247768 GCGCGAGGGTGCTGCCACCATGG + Intronic
1068696231 10:59970681-59970703 GCCTGAGGGTGGAACCTCCAGGG - Intergenic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1072215802 10:93286192-93286214 GCATGAGGGTGCAGCCCTCATGG + Intergenic
1075614770 10:123883068-123883090 GCCTGGGGGTGCCCGGGCCATGG - Intronic
1076060993 10:127413758-127413780 ACCTGAGGGAGCCGTCCCCATGG + Intronic
1076125644 10:127971781-127971803 GCCTGAGGGAGCCACCCACATGG - Intronic
1076478117 10:130766674-130766696 CCCTGAGGGTGCAGTCTCCATGG - Intergenic
1079414093 11:20216677-20216699 GCCTGATGGTGCCCACGCCCAGG - Intergenic
1080647085 11:34195147-34195169 GCCTGAGGGCCCAGCAGCCAGGG + Intronic
1083721079 11:64603818-64603840 GCCTGAGGCCTCCACCGCCATGG - Intergenic
1084672796 11:70616889-70616911 GCCACAGGGTGCAGCAGCCAGGG + Intronic
1091738180 12:2940637-2940659 GTCTGAGGGAGCAGCCGCCACGG - Exonic
1091776071 12:3185713-3185735 GCCTGATGGGGCAGCCGCCTGGG + Intronic
1092145772 12:6213742-6213764 GCCTGAGGGTGCAGCTTCCCAGG + Intronic
1102347792 12:112170531-112170553 GCCTGAGAGTGCCACACCCAGGG - Intronic
1104441682 12:128798343-128798365 GGCTGTGGGTGCCACCTCCATGG - Intronic
1104720017 12:131040038-131040060 GCCTGAGGGTGCCGCTGGTGGGG - Intronic
1113200999 13:107867343-107867365 GCCCGCGGGCGCCGCCGCCGGGG + Intergenic
1113848717 13:113406107-113406129 GCCTGAGGGTGTCACCCCGATGG - Intergenic
1121017189 14:90555976-90555998 GCCTTAGGCTGCAGCCGGCAGGG - Intronic
1121604741 14:95232207-95232229 GCCTGAGGCTGCAGCCTCCTCGG + Intronic
1122221038 14:100239222-100239244 GGCTGAGGGCTCCGCCGCCACGG - Exonic
1122631813 14:103110722-103110744 GCCTGTGGCTGCCCCCACCACGG + Intergenic
1122969998 14:105148608-105148630 GCCAGGGGGTGCTGCCACCATGG - Intronic
1122971225 14:105153012-105153034 ACTTGAGGGTGCCTCCGTCAGGG + Intronic
1124983323 15:34583464-34583486 GCCCCAGGTTGCCGCCGCCAGGG + Intronic
1125535677 15:40440439-40440461 GCCGGAGGCTGCTGCCCCCAGGG - Intronic
1127268019 15:57376639-57376661 CCCTGGGGGTCCCGCCGCCCTGG - Intronic
1132629431 16:909860-909882 GCCAGAGTGTGCCGCCGTCTCGG - Intronic
1132759390 16:1501470-1501492 GCCTGCGGGTGACGGCGCCTCGG + Exonic
1132797696 16:1733444-1733466 GCCTGATGCTGCCGTCGTCATGG + Intronic
1133056878 16:3149803-3149825 GCCTGAGGGTGCGGCGGCCACGG + Exonic
1133247712 16:4460316-4460338 GCCTGGGGGTGCCAGAGCCAGGG + Intergenic
1142133233 16:88440371-88440393 GCATGAGGGTGCCCTGGCCAGGG - Exonic
1142273763 16:89105033-89105055 CCCTGAGGGCCCCGTCGCCAGGG + Intronic
1142273776 16:89105074-89105096 CCCTGAGGGCCCCGTCGCCAGGG + Intronic
1147842085 17:43378989-43379011 CCCTGAGGGGGCTGCCGCCCTGG + Intergenic
1150797187 17:68247912-68247934 CCCTGAGCGTGCGGCCGCCTGGG - Exonic
1152804087 17:82346856-82346878 GTCTGAGGGCGCAGCAGCCAAGG + Intergenic
1154008016 18:10550154-10550176 GCCTGATGGTGTCACTGCCACGG + Exonic
1154412168 18:14147325-14147347 GCCTAAGGGAGCTGCCCCCATGG + Intergenic
1157442203 18:47719654-47719676 GCCTGATGGAGCAGCCGCCTAGG - Intergenic
1160221325 18:76980062-76980084 GCGCAAGGGTGCCGCAGCCACGG + Intronic
1161584810 19:5099696-5099718 GCCTGAGGGTGGCACCCTCATGG + Intronic
1162375818 19:10304867-10304889 TCCTGAGGGGGCCTCGGCCAAGG + Exonic
1162463968 19:10829946-10829968 GCCTGAGGGGGCCGAGGGCAAGG + Intronic
1168403397 19:56098718-56098740 GCCGCAGGGTGATGCCGCCAGGG + Intronic
933403302 2:81826377-81826399 GCCTGAGGGTGTTGCCATCATGG + Intergenic
940691651 2:156926393-156926415 CCATGAGGGTGCCGCCACCTAGG + Intergenic
942451009 2:176107964-176107986 GCCCGAGGGCGCAGCCGACAAGG + Exonic
944581555 2:201137087-201137109 GCCTGAGGGGGCAGCGGCCTGGG + Intronic
947718408 2:232352999-232353021 GCCTGCGAGTGCGGCCCCCATGG + Intergenic
1172835009 20:37867897-37867919 GCCTGAGGGTGCAGCTTCCCCGG + Intronic
1175315671 20:58044916-58044938 CCCTGAGGGTGCCTCCCCCAGGG + Intergenic
1179375011 21:40842195-40842217 GGCTGAGGGTGCGGGCACCAAGG + Intronic
1179712193 21:43269658-43269680 TCCTGAGGATGCCTCCACCAGGG - Intergenic
1179959081 21:44758314-44758336 GCCAGAGGGTGCCACCTCCCTGG + Intergenic
1179996398 21:44976400-44976422 GGCTGATGGGGCTGCCGCCAAGG - Intronic
1180950547 22:19718719-19718741 GCCTGGGGGGGTCGCCGCGATGG + Intronic
1181102841 22:20552901-20552923 GCCTTAGGGAGCTGCCCCCAAGG - Intronic
1183486241 22:38089077-38089099 GCCTGTGAGTGCCCCCGCCCCGG - Exonic
1184462795 22:44648789-44648811 GCCTGGGGGAGCGGCCACCAGGG + Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
951016949 3:17742275-17742297 GCCTGAGGGTGCCGCCGCCACGG - Intronic
954150904 3:48656535-48656557 GCCGGAAGGGGCCGCCGCCGAGG - Intronic
956077833 3:65525049-65525071 GACTGAGGGTGCTGGAGCCAAGG - Intronic
961645749 3:128391970-128391992 GCCTGAGTGTGCCCCAGCCGTGG + Intronic
961682524 3:128608511-128608533 GCCAGAGGGCGCCCCCGCCTAGG - Intergenic
962222471 3:133574521-133574543 CCCGGAGGGTGGCGCCGCCCGGG - Intronic
962343238 3:134602292-134602314 GCCTCAGGCTGCCGTTGCCATGG - Intronic
965071993 3:163925886-163925908 GCAGGAGAGTGCCCCCGCCAAGG - Intergenic
968913541 4:3487389-3487411 GCTTGAGGATGCCGCCCGCAGGG - Intronic
969699981 4:8762548-8762570 GCCACAGGGTGCCGCTGCCCAGG + Intergenic
971903958 4:32701180-32701202 TCATGAGGGTGCAGCCACCATGG - Intergenic
972312070 4:37891128-37891150 GCCTGTTGCTGCCGCCGCCGCGG + Exonic
974047164 4:56907994-56908016 GGCTGCGGCAGCCGCCGCCAGGG - Exonic
985182428 4:187279820-187279842 TCCTCAGGGTGCCTCCTCCAGGG - Intergenic
985691399 5:1314670-1314692 GCCTGAGTGTCCCCCAGCCACGG - Intergenic
988291733 5:29296579-29296601 GCCTGAGCGTCCCCCCGCCATGG - Intergenic
995853975 5:116574111-116574133 GCCTGAGGGTCCCGGGGCCGTGG - Intronic
996329320 5:122311956-122311978 GCCTGAGGGCGCGGCGGCCCCGG + Intronic
999704834 5:154262716-154262738 TCTTGAGGGTGCAGCCTCCAGGG - Intronic
1002926573 6:1609059-1609081 GCCTGAGGGTGCGGGCGGCGAGG - Intergenic
1011434534 6:87322684-87322706 GCGTGATGGTGCGGCCGCCCTGG - Intronic
1017662433 6:156687468-156687490 GCCGGAGGCTGGCGCCGCCGAGG - Intergenic
1018873060 6:167797442-167797464 GGCGGAGGATGCTGCCGCCAAGG + Intergenic
1018981739 6:168606884-168606906 GCCTGAGGAGGCCGCCACGAAGG + Intronic
1024199401 7:47090676-47090698 AGCTGAGGGTGCCACTGCCATGG - Intergenic
1025237286 7:57243451-57243473 ACCTGAGGGTGCAGCAGCCTTGG - Intergenic
1029496348 7:100897093-100897115 GCACGCGGGCGCCGCCGCCAGGG + Intergenic
1034352685 7:150427726-150427748 GGCAGAGGGTGCAGCCCCCAGGG - Intergenic
1035459293 7:159029418-159029440 GCCTGAAGGAGCAGCCGCTAGGG + Exonic
1037890000 8:22619022-22619044 GCCTGGGGCTGCAGCCACCATGG + Intronic
1038188148 8:25294278-25294300 GCCTGTGGGTCTGGCCGCCATGG + Intronic
1039593530 8:38770370-38770392 ACCCGAGGGTGCCGCCGGGACGG - Intronic
1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG + Exonic
1049654863 8:143792975-143792997 GCCTGAGGATGCCCCTGCCCAGG - Exonic
1056763922 9:89433291-89433313 GACTGAGGGTGGGGCCACCAGGG + Intronic
1057312842 9:93952527-93952549 GCCTGAAGGTGCCGCGGGAAAGG + Intronic
1058814102 9:108668026-108668048 CCCTTAGGGTGCCCCTGCCAGGG - Intergenic
1059527552 9:115006516-115006538 GTCTGATGGTGCTGCAGCCAAGG - Intergenic
1059800449 9:117745044-117745066 GGCTCAGGGAGCCGCGGCCACGG + Intergenic
1060784129 9:126435755-126435777 GCCTCTGGGTGCCGCCGGCCTGG - Intronic
1061006455 9:127930897-127930919 GCCTGCGGGTCCCGCCCCCACGG + Intergenic
1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG + Intergenic
1062070967 9:134554798-134554820 GCCTGGGGGTGGAGCCTCCATGG - Intergenic
1062294646 9:135817947-135817969 GCCTGAGACGGCCGCCGGCACGG - Intronic
1187456206 X:19443417-19443439 GCCTGAGGGGGCAGGGGCCATGG - Intronic
1190919512 X:54839052-54839074 GCCTGTGGTTGCAGCGGCCATGG - Intergenic
1193664632 X:84300457-84300479 GCCTGAGGTGGCCGTGGCCATGG + Intergenic
1194393153 X:93346352-93346374 GCCTGAGGTGGCGGCGGCCATGG - Intergenic
1198468130 X:136921635-136921657 GCCTGAGCCTCCCCCCGCCATGG + Intergenic
1201063820 Y:10070367-10070389 GCCTGGGTGTGCTGCCTCCAGGG - Intergenic