ID: 951017584

View in Genome Browser
Species Human (GRCh38)
Location 3:17746963-17746985
Sequence CGAATGTTCTTAAAGTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951017584 Original CRISPR CGAATGTTCTTAAAGTCTCT TGG Intronic
901906378 1:12415559-12415581 CCCATGTTCTTAGAGTCTGTGGG + Intronic
905530154 1:38671871-38671893 AGAATGTTCTAGAACTCTCTCGG + Intergenic
906676338 1:47696363-47696385 GGAATGGTTTTAAAGTCTCATGG - Intergenic
906878039 1:49559073-49559095 CCGATGTTCATAAAGGCTCTGGG - Intronic
908391280 1:63685878-63685900 GGAATTTTCTTAACCTCTCTGGG - Intergenic
910629829 1:89343234-89343256 CAAGTGTTCTCAAAGTCACTAGG + Intergenic
911271365 1:95805719-95805741 CTACTGTTCTTACAGCCTCTGGG + Intergenic
923525476 1:234769337-234769359 CAAGTGATCTTAAACTCTCTGGG - Intergenic
1067971312 10:50973908-50973930 GGAATGTTCTTAATCTCTGTGGG - Intergenic
1068923254 10:62507878-62507900 TGCATGTTCTTTAAGTGTCTTGG + Intronic
1074389769 10:113047314-113047336 GGAATGATTTTAATGTCTCTGGG + Intronic
1076535102 10:131172184-131172206 CGCATGTTCTTACAGCCTCATGG - Intronic
1082115247 11:48321024-48321046 CAAATGTCCTTCTAGTCTCTAGG - Intergenic
1082258426 11:50058263-50058285 CAAATGTCCTTCTAGTCTCTGGG + Intergenic
1086628243 11:88985672-88985694 CAAATCTTCTGAAAGTGTCTTGG - Intronic
1095453665 12:42359325-42359347 CAAATGCTCTTCTAGTCTCTGGG + Intronic
1095635843 12:44432710-44432732 TGAATGTTTTTAAAGACACTTGG + Intergenic
1096440782 12:51641917-51641939 GCATTGTTCTTTAAGTCTCTTGG - Intronic
1096712189 12:53465427-53465449 CCAGTGTTCTTAAGGTCTTTAGG + Intronic
1098068844 12:66649974-66649996 AGAAAGTTTTTAAAGGCTCTAGG + Intronic
1103734007 12:123047351-123047373 CTAATGTTCTTAAATGATCTAGG + Intronic
1105473169 13:20709874-20709896 CGTTTGCTCTTAAAGGCTCTGGG + Intronic
1108677998 13:52754503-52754525 CGAAGGTTCTTACAGGCTCAGGG - Intergenic
1111937778 13:94574011-94574033 CAAGTCTTCTTAAAGTCTTTAGG + Intergenic
1112816214 13:103276698-103276720 CCCATGATCTTAAAGTCCCTTGG - Intergenic
1114685315 14:24525260-24525282 CTAATGTTCTTGAATTCTCCAGG - Intergenic
1114789645 14:25642558-25642580 GGAATGTTATAAAAGTCTTTTGG - Intergenic
1114849897 14:26371382-26371404 CGAACATTCTGAAGGTCTCTGGG - Intergenic
1115333517 14:32222544-32222566 CGAAAGTTCTTCCAGACTCTAGG - Intergenic
1116606656 14:47007015-47007037 GAAATATTCTTAAAGTTTCTTGG - Intronic
1117039773 14:51759325-51759347 CTAATGTTTTTAAAATGTCTCGG - Intergenic
1117408404 14:55427563-55427585 CAGATGCTCTTAAATTCTCTTGG - Intronic
1119196002 14:72716978-72717000 CTAATGGTCTGAAAGTCCCTTGG - Intronic
1119906360 14:78305881-78305903 CTAATGTTTTGAAAGTCTGTGGG + Intronic
1120962358 14:90136878-90136900 CGAAGGTCTTTAAAGTCTCAAGG + Intronic
1122466335 14:101936226-101936248 TGAATTTCTTTAAAGTCTCTAGG + Intergenic
1128624474 15:69185784-69185806 GGCATGTTCTTAAATTCTCCAGG - Intronic
1129638385 15:77347613-77347635 AAAATTTTTTTAAAGTCTCTGGG - Intronic
1134676348 16:16093339-16093361 AAAATGTCCTTAAACTCTCTTGG + Intronic
1151024270 17:70658778-70658800 AAAATATTCTTAAATTCTCTTGG - Intergenic
1153968613 18:10204310-10204332 CTAGGGTTCCTAAAGTCTCTTGG + Intergenic
1156162519 18:34376670-34376692 CCAATGTTGTTAAATTCTGTAGG - Intergenic
1157653609 18:49362531-49362553 AGAATTTTCTGTAAGTCTCTTGG + Intronic
1157752040 18:50187820-50187842 CCAATGTTCTTCAAGTGTCAAGG + Intronic
1158892889 18:61889594-61889616 CAAATGTCCCTAAACTCTCTGGG + Intronic
1159130421 18:64275111-64275133 AAAATATTCTCAAAGTCTCTTGG - Intergenic
1161649048 19:5472955-5472977 TGAATGTTTTTAACCTCTCTGGG + Intergenic
931485753 2:62689975-62689997 TGAATGTTTTTAAAGTTTCTTGG + Intronic
933432671 2:82204226-82204248 CTAATTTTCTTATAGTGTCTTGG - Intergenic
938271218 2:129973692-129973714 CCCATGTTTTTAAAATCTCTTGG - Intergenic
941692467 2:168515448-168515470 CAAATGTTCTCAAAGATTCTGGG - Intronic
943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG + Intergenic
1172926313 20:38539478-38539500 CCCATGTTCTTTCAGTCTCTGGG + Intronic
1173825303 20:46044339-46044361 CGACTGCACTTAAAGTCTGTTGG - Intronic
1174441556 20:50559461-50559483 AGAATGTTCTGTAAGTTTCTGGG - Intronic
1174963788 20:55187688-55187710 CCAGTGTTCCTAAAGTTTCTAGG + Intergenic
1176789830 21:13307518-13307540 CAAATTTTCTTAAAGTCTTGGGG + Intergenic
1178448317 21:32665823-32665845 TGAATATTCTTAATGTTTCTAGG + Intronic
1179811204 21:43871110-43871132 CTACTGTTTTTACAGTCTCTGGG + Intronic
949103664 3:177711-177733 CGAATGTGCTTACACTGTCTTGG + Intergenic
950912224 3:16606112-16606134 AGAATGTTCTAGAATTCTCTAGG - Intronic
951017584 3:17746963-17746985 CGAATGTTCTTAAAGTCTCTTGG + Intronic
953799847 3:46014316-46014338 AGGATGTTTTTAAAGTCTCCTGG - Intergenic
954998877 3:54908041-54908063 CCTATGTTTTTATAGTCTCTTGG + Intronic
955966343 3:64392924-64392946 AGGATGTTGTTAAAGTCTGTAGG - Intronic
956918268 3:73897889-73897911 TGAATGATCTTAAATTCTGTTGG + Intergenic
957453151 3:80405543-80405565 AGATTGTTCTTAAAAACTCTTGG - Intergenic
959523916 3:107354500-107354522 CGAAGGTTCTTGAACTGTCTTGG - Intergenic
961420270 3:126797534-126797556 AGAATGTTCTTGAAGTCCCACGG - Intronic
967270977 3:187732200-187732222 TGAATATTCTTAAAGTCACAGGG + Intronic
970880268 4:20920440-20920462 AGAATGTTCATAATGTGTCTGGG - Intronic
972124388 4:35744860-35744882 CGGATGTTCTTCAAGAATCTTGG - Intergenic
974002968 4:56529631-56529653 CCTATGTTTTTAAAGTCTCTTGG + Intergenic
975538681 4:75480150-75480172 CAAATGTACTCAAAGTCTCTAGG - Exonic
975551997 4:75622853-75622875 CCAATGTTCATAAACACTCTAGG - Intronic
975916741 4:79334078-79334100 AGAATTTTCTTAAAGTATCCAGG + Intergenic
977665352 4:99640776-99640798 CGAATCTCCTTATAGTTTCTTGG - Exonic
978252731 4:106652524-106652546 TAAATGTTGTTGAAGTCTCTAGG - Intergenic
980746051 4:137017732-137017754 CAAAGTTTCTTAAAGTCTTTTGG + Intergenic
984009896 4:174358113-174358135 GGAATGTTGTGAAATTCTCTAGG - Intergenic
985906422 5:2841121-2841143 CAAAAGTTCTTAAAGTTTTTGGG - Intergenic
990953041 5:61317446-61317468 TGAATGTTTTTAAAGCTTCTGGG - Intergenic
991610804 5:68448081-68448103 ATAATGTTCCTAAAGTCTCAGGG + Intergenic
999663517 5:153890019-153890041 CCAATTTTCTTAACTTCTCTGGG - Intergenic
1000934922 5:167295979-167296001 CAAATGTTATAAAAGTCTGTTGG - Intronic
1005688174 6:28275488-28275510 TGCATGTGCTTACAGTCTCTTGG + Intronic
1014258847 6:119192933-119192955 AGAAACTACTTAAAGTCTCTAGG - Intronic
1014848831 6:126314355-126314377 CACATGTTCTTAAGGTCTCCTGG + Intergenic
1020812175 7:12861882-12861904 AGCATGTTCTTAAATTCTCTAGG - Intergenic
1020842904 7:13243171-13243193 TGAATGTTCTAAGAGTGTCTCGG - Intergenic
1021164882 7:17325488-17325510 TGGATATTCTTAAATTCTCTTGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027203974 7:76082429-76082451 CCAAAGTTCTTAAAGGCTCTTGG - Intergenic
1028305318 7:89256178-89256200 AGAATATTGTAAAAGTCTCTTGG - Intronic
1030920908 7:115385267-115385289 CAAACGTTCTTAAAGTCTCTTGG + Intergenic
1033547931 7:142418917-142418939 CCAGTGTTCTGCAAGTCTCTGGG - Intergenic
1042350904 8:67776570-67776592 TAAATGTTCTCAAAGTATCTAGG + Intergenic
1043377912 8:79670674-79670696 CCAATGTTCTTCATGGCTCTTGG + Intergenic
1043636479 8:82390242-82390264 GGAATGTTCTTACAGTGACTTGG - Intergenic
1044968571 8:97597433-97597455 GGAATTTTCTTAACCTCTCTAGG + Intergenic
1048637989 8:136320625-136320647 AGAATGTTTTTTAAGTCTTTTGG + Intergenic
1050946737 9:11530935-11530957 CAAATCTTCTGAAAGTGTCTGGG + Intergenic
1051709480 9:19915850-19915872 CAAATTTTCTTATATTCTCTGGG + Intergenic
1052002178 9:23297309-23297331 AGAACTTTCTTAAATTCTCTTGG - Intergenic
1052440682 9:28493016-28493038 CTCATGTTTTTCAAGTCTCTAGG + Intronic
1055978789 9:81980044-81980066 TGAAGGTTCTTAAAGTCTATTGG - Intergenic
1057469914 9:95348449-95348471 CGAAAATTCTAAAAGTATCTGGG + Intergenic
1060500888 9:124153973-124153995 AGAATATTTTTAAAATCTCTTGG - Intergenic
1060537889 9:124406043-124406065 GGCAAGTTCTTAATGTCTCTGGG - Intronic
1060845374 9:126832741-126832763 AGAATGTTCTCAAACACTCTTGG - Exonic
1188654772 X:32679509-32679531 CGAAAGTTCTTAAAGTCTAGGGG + Intronic
1189732143 X:44032669-44032691 CGTAGGTTCATAAGGTCTCTTGG - Intergenic
1192605538 X:72512976-72512998 AAAATGTTCTTCAAGCCTCTGGG + Intronic
1195245245 X:102989501-102989523 GGATTGTTCTTAAACTCCCTAGG - Intergenic
1200512509 Y:4098749-4098771 TGAATGTTCTTGAATTCTCATGG - Intergenic
1202282049 Y:23199676-23199698 AGAATGTTCTGTAAGTCTCTAGG - Intergenic
1202283842 Y:23218843-23218865 AGAATGTTCTGTAAGTCTCTAGG + Intergenic
1202433721 Y:24814061-24814083 AGAATGTTCTGTAAGTCTCTAGG - Intergenic
1202435518 Y:24833229-24833251 AGAATGTTCTGTAAGTCTCTAGG + Intergenic