ID: 951018023

View in Genome Browser
Species Human (GRCh38)
Location 3:17750829-17750851
Sequence TGATAGATATATAAATTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 590}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951018023 Original CRISPR TGATAGATATATAAATTGAA TGG (reversed) Intronic
901567118 1:10126337-10126359 AGATAGATAGATAGATAGAAAGG + Intronic
906728505 1:48061482-48061504 TGATAGATTTTTAAATAGTAGGG - Intergenic
907631532 1:56087960-56087982 TGATAAATATAAAAATCAAAAGG + Intergenic
908623824 1:66017269-66017291 TAATTGATATATAAATTGATAGG - Intronic
909021201 1:70433293-70433315 TGATTGATATATATTTTGGATGG + Intronic
909215556 1:72883448-72883470 TGATTGATCAATAAATAGAAAGG + Intergenic
909296304 1:73953556-73953578 TGCTAGATATATATCTTTAATGG - Intergenic
909690514 1:78402147-78402169 AGATAGATAGATAAATAGATAGG - Intronic
909890374 1:80998042-80998064 AGATAGATAGATAGATTGATAGG + Intergenic
910275456 1:85444859-85444881 GAATAGATATATAAATAAAAAGG + Intronic
910320442 1:85937589-85937611 TGATGGATATATGAATGGAATGG + Intronic
911002293 1:93179476-93179498 TAATGGATATATAACTTAAACGG + Intronic
911905461 1:103562783-103562805 TGATAGTTATATAAGTAGAAAGG + Intronic
912042162 1:105404961-105404983 AGATAAATATAGAAATTTAAAGG + Intergenic
912075644 1:105872348-105872370 TAATAGATTTATGAATAGAATGG - Intergenic
912090883 1:106074264-106074286 TGATAGATAGATAGATAGATAGG + Intergenic
912106306 1:106280868-106280890 TAATAGATTTATAAATTGGTGGG + Intergenic
912613070 1:111068327-111068349 TGTTACATGTATAAATTGCATGG + Intergenic
913096617 1:115523502-115523524 TTATACATTTATAAATTGACTGG + Intergenic
913404760 1:118477250-118477272 TAATTGATATATTAATTCAAAGG + Intergenic
913472804 1:119206477-119206499 ACATATATATATAATTTGAAAGG - Intergenic
914202981 1:145502917-145502939 TGATATATGTATACACTGAATGG - Intergenic
914236911 1:145820851-145820873 TGATATATGTATACACTGAATGG - Intronic
914482103 1:148076068-148076090 TGATATATGTATACACTGAATGG - Intergenic
916244517 1:162673999-162674021 AGCTAGAGATATAAATTGGAGGG - Intronic
916710952 1:167407542-167407564 ATATAGATATATAGATTAAATGG + Intronic
916897545 1:169181125-169181147 AGATAGATAGATAAATAGATAGG - Intronic
917299732 1:173560687-173560709 TGCTAGATTTACAAATTCAAAGG - Intronic
917384505 1:174455104-174455126 TGATAAATATTTAACATGAAAGG + Intronic
917639024 1:176964425-176964447 TGATAGATTGACAAAATGAATGG + Intronic
918488095 1:185050695-185050717 TTACAGATAGAAAAATTGAAAGG + Intronic
918626040 1:186656903-186656925 TGATACATCAATAACTTGAATGG + Intergenic
918873933 1:190013735-190013757 TGATATATATATATATATAATGG + Intergenic
918942083 1:191013556-191013578 TGTTAGATATATGGATTCAATGG - Intergenic
919406055 1:197185680-197185702 AGAAAGTCATATAAATTGAAAGG - Intronic
920153375 1:203927827-203927849 TTTTAAATATATAAATAGAAGGG + Intergenic
920611807 1:207447546-207447568 AGATAGATATATAGATAGATAGG + Intergenic
921219069 1:212960539-212960561 AGATAAATAAATAAAGTGAATGG - Intronic
921819714 1:219603395-219603417 TCATAGATATATAACTAAAAGGG - Intergenic
921957798 1:221001995-221002017 GGATAGATAGATAAATGGATAGG - Intergenic
922232355 1:223698148-223698170 AGATAGATACATAAATAGATGGG + Intergenic
922420329 1:225456052-225456074 AGATATATAGATAAATGGAATGG + Intergenic
923040411 1:230315711-230315733 AGATAGATATATATATTAAGTGG + Intergenic
923256750 1:232228350-232228372 TGACAGCTATGTAAATAGAAAGG - Intergenic
923631597 1:235652237-235652259 AGATAGATTTAAAAATTAAAAGG - Intergenic
924389024 1:243531066-243531088 GGATAGATAGATAGATAGAATGG - Intronic
1062993049 10:1837751-1837773 GGATAGATGTATATATGGAAGGG - Intergenic
1063687497 10:8251949-8251971 ATATATATATATAAATTAAATGG + Intergenic
1064430165 10:15263714-15263736 AGATAGATAGATAGATTGATAGG - Intronic
1065033113 10:21608634-21608656 TGATACATATGTAAATTTAATGG + Intronic
1066583366 10:36904981-36905003 TGATAGATATATAAAACAAAAGG - Intergenic
1067783357 10:49225333-49225355 TGTCAGATATGTAAATCGAAGGG + Intergenic
1067940984 10:50656061-50656083 TGATAGATAGATAGATAGATAGG + Intergenic
1068106325 10:52621289-52621311 TGAAAGATCTAGAAATTGAATGG - Intergenic
1068135100 10:52944809-52944831 TGATAGAAATAGAAATAGAGAGG + Intergenic
1068311906 10:55289669-55289691 AGATAGATAGATTAATTAAATGG - Intronic
1068457638 10:57279270-57279292 TGATATATATATAAAATAATTGG + Intergenic
1068471071 10:57464499-57464521 TGATAGACATATATATTTATGGG + Intergenic
1068868237 10:61917315-61917337 TAATAAATAAATAAATAGAATGG - Intronic
1069190478 10:65481406-65481428 TAATAGAGAGATAAATTGAATGG + Intergenic
1069330982 10:67292564-67292586 TTATAGATATAAAAATGGGAGGG - Intronic
1069478366 10:68757724-68757746 TTATATACATATAAATTAAAAGG + Intronic
1069576441 10:69533301-69533323 TGATATATATATATATAAAACGG + Intergenic
1070241309 10:74684289-74684311 TGTTAAATATATGAATTTAATGG + Intronic
1070282652 10:75061222-75061244 TGATAGAAATTTAAAAGGAAAGG + Intergenic
1071061628 10:81576803-81576825 TGATATTTAGATAAATTTAAGGG + Intergenic
1071186172 10:83048628-83048650 TGTTAGAAATATAAATTGTCAGG - Intergenic
1072076050 10:91975017-91975039 TGATAGATATATATATTAATAGG - Intronic
1072912012 10:99510730-99510752 TGATGGTTTTATAAATAGAAGGG - Intergenic
1073383427 10:103100234-103100256 TGATAGAAGAATATATTGAATGG + Intronic
1073415118 10:103374689-103374711 TATTAGATATATACTTTGAAAGG + Intronic
1073744860 10:106456453-106456475 TAATAATTATATAAATTGGATGG + Intergenic
1073778259 10:106809665-106809687 TTATATATATATATAGTGAAGGG - Intronic
1073944435 10:108733639-108733661 TTATAAATATATAAATTAAGGGG + Intergenic
1074074225 10:110106626-110106648 TGATAGATATATAAAATAAAAGG + Intronic
1074443387 10:113498131-113498153 AAATAAATAAATAAATTGAATGG - Intergenic
1076103356 10:127800388-127800410 GGATAGATATATATATATAAAGG - Intergenic
1077830256 11:5860506-5860528 TCATAGATATATATATTTATGGG + Intronic
1078420834 11:11211263-11211285 TGATATTTTTAAAAATTGAAGGG - Intergenic
1078943998 11:16043395-16043417 TGTTAAATATATACATTGTAGGG - Intronic
1079045286 11:17096429-17096451 GGATATATATATAAACTTAAAGG + Intronic
1079199208 11:18360438-18360460 TGAAAGATATTCACATTGAAGGG + Intronic
1079487513 11:20950909-20950931 TGATAAATATGCTAATTGAAAGG - Intronic
1079523873 11:21361964-21361986 TGCTAGATAAAGAATTTGAAAGG - Intronic
1079869487 11:25780015-25780037 GGATATATATATAAATTGTTTGG + Intergenic
1080065789 11:28011479-28011501 TGATAGATATAGATATAGATAGG - Intergenic
1080149003 11:29025676-29025698 TGATTGAGATTTAAATTGAGGGG + Intergenic
1080592204 11:33734316-33734338 TGATATACATATAAATTCTAGGG + Intronic
1080829311 11:35876642-35876664 TTATATATATATATATTTAAAGG + Intergenic
1081117771 11:39225658-39225680 TGATAGATAAACAAAAAGAAAGG - Intergenic
1081482327 11:43501349-43501371 TGCTGGACATATAAATTGGAAGG - Intergenic
1082274859 11:50210552-50210574 AGATAGATAGATAAATAGATAGG - Intergenic
1084194329 11:67515756-67515778 TGATAGATAGATAGATAGATAGG - Intergenic
1086276867 11:85140456-85140478 TGATAGTTATATATATTTATAGG + Intronic
1086346182 11:85899783-85899805 ATATAGATATATTCATTGAAGGG + Intronic
1087343007 11:96932929-96932951 TGAAAGAAAAATAAATGGAAGGG - Intergenic
1087353476 11:97062776-97062798 TGTAAAAGATATAAATTGAATGG + Intergenic
1087945393 11:104154112-104154134 TAATAGTTGTATAAATTGATAGG + Intronic
1088173314 11:107020041-107020063 ATATATATATATAATTTGAAGGG - Intergenic
1088666090 11:112095257-112095279 TAAGAGATTGATAAATTGAAAGG - Intronic
1089549303 11:119258618-119258640 AGATACATAGATCAATTGAATGG - Intronic
1089656642 11:119951976-119951998 TAATTAATATATAAATTGATAGG + Intergenic
1089880582 11:121769528-121769550 AGATGGATATGTAAATTGGAGGG - Intergenic
1090854084 11:130597158-130597180 GGATAGATAGATAAATAGATAGG + Intergenic
1092891076 12:12969741-12969763 AGTTAGAAATATAAATTCAAAGG + Intergenic
1093107585 12:15107732-15107754 TGAAACATTTATAATTTGAAGGG - Intergenic
1093422982 12:18996237-18996259 AGACAGACATATAAAATGAAAGG - Intergenic
1093591813 12:20910913-20910935 TGGTATATATACAGATTGAAAGG - Intronic
1094555326 12:31493950-31493972 TGATAGATATAGAAATGAATTGG - Intronic
1094794783 12:33958967-33958989 TGACAGATATAAAAAGGGAAAGG + Intergenic
1095106636 12:38241594-38241616 TGACAGATATATAAAGGGAAAGG + Intergenic
1095272199 12:40232391-40232413 TGATAGATATGTAAAACAAATGG + Intronic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1095627419 12:44333112-44333134 TGAGAGATCTATAAATTGTCTGG - Intronic
1096601069 12:52729947-52729969 TGATAGATAAATAGTTTCAAAGG + Intergenic
1096849313 12:54425576-54425598 TGAAAGGAATATAAACTGAAGGG - Intergenic
1097136309 12:56859312-56859334 GGATAGATATATATATATAAAGG - Intergenic
1098692478 12:73505894-73505916 TGTTGCATATATAAATGGAACGG + Intergenic
1098814986 12:75148105-75148127 TGATATATGTATACATTGTAGGG - Intronic
1098928405 12:76379990-76380012 TGGTAGATGTATAAATTAATGGG - Intronic
1099006351 12:77239001-77239023 TGATAGATAGATAGATAGATAGG - Intergenic
1099082232 12:78199403-78199425 TCATAGAGATAGAAATTGAAAGG + Exonic
1099211663 12:79798627-79798649 TGATAGATATTTACATTCACAGG - Intronic
1099697743 12:86043195-86043217 TGATAGATGTATATATAAAAGGG + Intronic
1100004862 12:89882451-89882473 TTAGAGATATTTAAATTGATTGG + Intergenic
1101039404 12:100739137-100739159 TTATATATATATAAATTATAAGG - Intronic
1101453554 12:104805877-104805899 AGATAGATATATACATAAAATGG + Intronic
1102750954 12:115293947-115293969 TGATATATATATAAACTGTGAGG - Intergenic
1103209727 12:119157442-119157464 TGATAGATAGAAAAACGGAAGGG + Exonic
1104164077 12:126209590-126209612 TGATACATGTATACATTGTAGGG + Intergenic
1104261011 12:127182064-127182086 GGATAGATGTATATATGGAAGGG + Intergenic
1104366313 12:128181087-128181109 GGATAGATGTATATATGGAAAGG + Intergenic
1104435405 12:128752407-128752429 TGATATATATATATTTTTAATGG + Intergenic
1105296889 13:19095582-19095604 TCATAGCTATATAGATTGGATGG + Intergenic
1105519434 13:21118359-21118381 TCATAGCTTTATAAATAGAATGG - Intergenic
1105536259 13:21267133-21267155 TGATACATATATATATAAAATGG + Intergenic
1106015050 13:25861311-25861333 TAATATATATTTAAATTAAAAGG - Intronic
1106240012 13:27904247-27904269 TGATAGATAGATAGATATAAAGG + Intergenic
1106380919 13:29238293-29238315 GGATAGATGTATAATATGAAAGG + Intronic
1106510971 13:30412309-30412331 TGATACATATATAGAAAGAAAGG + Intergenic
1106855657 13:33849042-33849064 TGATAGATAGATAGATAGACAGG + Intronic
1107171170 13:37343273-37343295 TGATAGATATCTCAATTAAATGG - Intergenic
1107401624 13:40074891-40074913 TGCTACATATATAACTGGAAAGG + Intergenic
1107673463 13:42770582-42770604 TGACAGAGATCTAAATTGGATGG - Intergenic
1107742599 13:43468006-43468028 AGACAGATAGATAAATGGAATGG - Intronic
1107878522 13:44812357-44812379 TGATAGATAACTATATTGAGAGG - Intergenic
1108247032 13:48527381-48527403 TGATATATATTTATATTAAAAGG + Intronic
1109410835 13:61966160-61966182 TTATATATATATAAATTTATTGG - Intergenic
1109509912 13:63357388-63357410 TTATAAATATAGAAATTTAATGG + Intergenic
1109585084 13:64389797-64389819 TAATAGATTTATAAACTGACAGG + Intergenic
1109603354 13:64661543-64661565 AGATAGATATATTAATGCAAAGG + Intergenic
1109671753 13:65617292-65617314 AGATAGATAGATAGATTGATAGG + Intergenic
1109725608 13:66337256-66337278 AAATATATATATAAATTGAATGG - Intronic
1109879672 13:68454843-68454865 TTATAGATATAAAATTTAAAAGG + Intergenic
1110031756 13:70624370-70624392 TAATATATATATAAAGAGAAAGG + Intergenic
1110126193 13:71945222-71945244 TGAAAATTATATAAATAGAAAGG + Intergenic
1110426910 13:75377806-75377828 TGATAGATATGTAGATAGATAGG - Intronic
1110754150 13:79152090-79152112 AGCTAAATATATAAATTTAAGGG - Intergenic
1111491869 13:88988401-88988423 TGCTTGATATATAAATGCAATGG + Intergenic
1112173878 13:97001833-97001855 TGAAAGATAAATAGATTCAAGGG + Intergenic
1113209163 13:107955083-107955105 TGATAGACATATACATAGACAGG + Intergenic
1113611556 13:111649014-111649036 TGAAAGGCATATAGATTGAAAGG - Intronic
1114708318 14:24750443-24750465 TGATAGATAAATATATAGATAGG - Intergenic
1114939016 14:27582313-27582335 TGAAAGATAAAAAAAATGAAAGG + Intergenic
1116127894 14:40812883-40812905 GGATATATGTATAAATTAAAGGG + Intergenic
1116166758 14:41343427-41343449 GGATAGATTTATATATTAAAGGG + Intergenic
1116237752 14:42301340-42301362 TGATAGAAATAGATGTTGAATGG + Intergenic
1117786332 14:59289766-59289788 TGATATATATATATATATAATGG + Intronic
1119677084 14:76563844-76563866 TGTTAAATAGATAGATTGAAGGG + Intergenic
1120046324 14:79811168-79811190 TGACAGATCTATAAATTCAATGG + Intronic
1120582857 14:86275312-86275334 TACTAGATATACAACTTGAACGG + Intergenic
1120822257 14:88922799-88922821 TAGTAGGTATATAAATTTAAGGG + Intergenic
1121689218 14:95863925-95863947 TAATAGATAAATAACATGAAGGG + Intergenic
1121969164 14:98340675-98340697 TGATAGATAGATCAATAGATAGG - Intergenic
1125142416 15:36424456-36424478 TGCTAAATATAACAATTGAAAGG + Intergenic
1125418889 15:39483037-39483059 TTATAGTTTCATAAATTGAAAGG - Intergenic
1126977870 15:54205752-54205774 TGTTCGAAGTATAAATTGAAAGG + Intronic
1127559989 15:60126763-60126785 AGATAGATAGATAGATTGATAGG - Intergenic
1134651344 16:15911351-15911373 TGATAGATGGATGAGTTGAATGG + Intergenic
1135162893 16:20113229-20113251 TGATATATATATATATAAAATGG + Intergenic
1136279227 16:29198215-29198237 TGATAGATATACAGATGGATGGG + Intergenic
1136700496 16:32134918-32134940 TGAGAGATATATACTTTGATAGG + Intergenic
1138223025 16:55269207-55269229 TGATAGATATATACGTAGATGGG - Intergenic
1138895202 16:61196239-61196261 TGATAGACATACATATTGAATGG + Intergenic
1138949124 16:61889266-61889288 TCATAGATTTATGAATTTAATGG - Intronic
1139737271 16:69002294-69002316 ATATATATATATAAATTAAAGGG - Intronic
1140069670 16:71638263-71638285 TGATAGATATTTGGACTGAAAGG - Intronic
1141899303 16:86980055-86980077 TGATAGATAGATAGATAGATAGG + Intergenic
1144606726 17:16672933-16672955 TGATAGAGATATAGATAGATAGG + Intergenic
1145262499 17:21363016-21363038 AGATAGATAGATAAATGGATGGG + Intergenic
1146204917 17:30895890-30895912 TGATAAATATGTATATTGTATGG + Intergenic
1146589574 17:34117118-34117140 TGACAGATTGATGAATTGAAGGG - Intronic
1149141856 17:53440818-53440840 GTATATATATATAAAATGAAGGG + Intergenic
1149421628 17:56517180-56517202 TGAAAGAGAAATAACTTGAATGG - Intergenic
1149885345 17:60334317-60334339 TAATAGATGTATAAATTTTATGG + Intronic
1151141869 17:72000863-72000885 AGATAGATAGATAGATTGAAAGG + Intergenic
1152004427 17:77670527-77670549 TTATATATATATAAACTGAATGG - Intergenic
1154063960 18:11089199-11089221 TGATACATATCTAAATTGCCTGG - Intronic
1154352198 18:13593601-13593623 AGACAGATATATAAATAGGATGG - Intronic
1154404939 18:14081808-14081830 TTATAAATATTTAAATTAAAAGG + Intronic
1155318084 18:24592050-24592072 AGATAGATATATAAAGTGGGGGG - Intergenic
1156630238 18:38958948-38958970 TTATAGATACATAAAATGAATGG - Intergenic
1156832352 18:41507482-41507504 TGCTAGATATAGAATTTTAAAGG + Intergenic
1156944142 18:42807102-42807124 TCAAAGATACATAATTTGAAAGG - Intronic
1157636868 18:49166275-49166297 TGTTAGATAGACAAAGTGAAAGG - Intronic
1157878942 18:51300120-51300142 TCATAGAAAAATAAATTAAAAGG + Intergenic
1158268855 18:55690385-55690407 TGATAGATAGATATATTAGATGG - Intergenic
1158775189 18:60570036-60570058 TGATAGATATATGTATTTCAGGG - Intergenic
1159124209 18:64204365-64204387 TGATAGGTATATATATTTATGGG - Intergenic
1159311267 18:66713635-66713657 ATATATATATATAATTTGAATGG - Intergenic
1159317872 18:66802837-66802859 TGATAGAAAAATAAAAAGAAAGG + Intergenic
1159355657 18:67335285-67335307 TCATAGATATAAAGCTTGAATGG - Intergenic
1159662520 18:71115981-71116003 TGATAAATATATAAATCTATGGG - Intergenic
1159790993 18:72778674-72778696 TTATAGAAATATAAATAGTAAGG - Intronic
1160444640 18:78917650-78917672 TGATAGATAAATAGATGGATGGG + Intergenic
1161858049 19:6777052-6777074 TGATAGATAGATGAATGGATGGG - Intronic
1163150093 19:15406406-15406428 TAATAAATATATAAATTTTAAGG - Intronic
1163176989 19:15571298-15571320 AGATAGATAGATAGATTAAATGG - Intergenic
1164797431 19:31045255-31045277 AGATGGATATATGAATTGATGGG + Intergenic
1165181075 19:33970503-33970525 AGATAGATAGATAAATTAGAGGG + Intergenic
1165217914 19:34289896-34289918 TTTTTAATATATAAATTGAAGGG + Intronic
1165369370 19:35394657-35394679 TGATAGATAGATAGATAGATAGG + Intergenic
1165663059 19:37599190-37599212 AGATAGATAGATAAACTTAAAGG + Intronic
1166153578 19:40893266-40893288 AGATAGATAGATAGATTGATAGG - Intronic
1167733366 19:51275640-51275662 TGATTGATTTATAATTTAAAAGG + Intergenic
1168150520 19:54445131-54445153 GGATATATGTATATATTGAAAGG - Intergenic
925773459 2:7307556-7307578 AGATAGATAGATAGATAGAATGG - Intergenic
926232495 2:11015147-11015169 GGATAGAAAAATCAATTGAACGG + Intergenic
926381186 2:12291604-12291626 TGAGAGATTTAAAAATAGAAGGG + Intergenic
926454487 2:13048205-13048227 TGAGAGATTTTTATATTGAAAGG - Intergenic
926474099 2:13300834-13300856 TGATATGTATAAAAATTGCATGG - Intergenic
926540888 2:14179916-14179938 TGATATATGTAAAAATTGGAAGG + Intergenic
927823617 2:26291327-26291349 TGATATATATGTAAATATAATGG - Intergenic
928116465 2:28548580-28548602 TTATATATATATATATAGAAGGG - Intronic
928474055 2:31606400-31606422 TGATAGTTGTATATATTTAAGGG - Intergenic
928577648 2:32671549-32671571 AGACAGACATATAAAGTGAATGG - Intronic
928647084 2:33366016-33366038 AGATAGATCTAGAACTTGAAAGG - Intronic
929743725 2:44632976-44632998 GGATAGATATATATATAGAAAGG - Intronic
929965593 2:46533237-46533259 AGATAGATAGATAGATAGAATGG + Intronic
930205168 2:48580539-48580561 AAATAGGTATATAAAATGAAGGG - Intronic
930411511 2:51031434-51031456 AGATATATATATATATTGAAGGG - Intronic
930795766 2:55389183-55389205 TGATAGAACTATATATTCAAAGG - Intronic
931203614 2:60125462-60125484 TGGTAGATGTCTGAATTGAAAGG - Intergenic
932637477 2:73404258-73404280 AAAAAGAAATATAAATTGAAAGG - Intronic
933044887 2:77523196-77523218 TGATATATATATAATTTAAAAGG + Intronic
933198755 2:79423564-79423586 ATGTAGATATAAAAATTGAATGG + Intronic
933360283 2:81273705-81273727 TAATAGATTTATAAGTAGAAAGG + Intergenic
933364992 2:81341305-81341327 TAATATATATATAATTTTAATGG - Intergenic
934151234 2:89149570-89149592 GGATAGATGTATAAATGAAAGGG - Intergenic
935352842 2:102168759-102168781 TGATAGATTTATACAGTAAATGG - Intronic
935485922 2:103653810-103653832 TGACAAATATATAAATTAAATGG + Intergenic
935514144 2:104013858-104013880 TTATAGATATATCAATCAAATGG - Intergenic
935983796 2:108652941-108652963 GGAAATATAGATAAATTGAAAGG + Intronic
936555320 2:113492275-113492297 TGATATATATATACATACAATGG + Intronic
937173231 2:119898806-119898828 TTATAGATATCTAGACTGAAGGG - Intronic
937473889 2:122197072-122197094 TGACAGATGTCTAAATAGAAAGG - Intergenic
937479648 2:122244895-122244917 TGATAAATAGAAAAATTGCATGG - Intergenic
937552353 2:123109411-123109433 GGATAGATCTATAAATCAAAAGG + Intergenic
938151443 2:128888693-128888715 GGATAGATATATAGATATAAAGG - Intergenic
938161828 2:128992065-128992087 TGTTAGATGTATAGTTTGAAAGG - Intergenic
938760084 2:134416991-134417013 TGATTTATATATATATTCAATGG - Intronic
939105510 2:137944183-137944205 ATATAGATAGATAAATAGAATGG - Intergenic
939514197 2:143145815-143145837 CTATACATATATAAATTGGAAGG - Intronic
939582890 2:143972012-143972034 TGAGAGATATAGAACTTAAATGG - Intronic
939854658 2:147343899-147343921 GCAATGATATATAAATTGAATGG - Intergenic
940096074 2:149977465-149977487 TGATAGATAGATGAATTGATAGG + Intergenic
940452163 2:153852874-153852896 GGATAGATGTATAAATGAAAGGG + Intergenic
940498230 2:154460797-154460819 TTATAGATAAATATTTTGAAAGG + Intergenic
940566926 2:155376759-155376781 TGAGAGAAATATAAATTTATAGG - Intergenic
940597818 2:155817790-155817812 TGATAAAAAGATCAATTGAATGG + Intergenic
940623134 2:156139374-156139396 AGATAAATATATAAATTAAAGGG + Intergenic
940627398 2:156192502-156192524 TGATAGATGTGGAAAATGAAAGG + Intergenic
940690632 2:156914963-156914985 TGATACATATAAAAATGGAGAGG - Intergenic
941106066 2:161354582-161354604 TCATAGATATCTAAAGTGATTGG + Intronic
941132362 2:161668878-161668900 TCATAGTGAAATAAATTGAAAGG - Intronic
941215602 2:162704271-162704293 TGATAGATTAAAAAATTAAAAGG + Intronic
941248331 2:163129782-163129804 TGATAGCTGTATAAAAGGAATGG + Intergenic
941264014 2:163336642-163336664 TGATAGGTATATATTTTTAAAGG - Intergenic
941405775 2:165085507-165085529 AGATAGAGATATAGATAGAAAGG - Intergenic
943165442 2:184317679-184317701 TGATAGACATATAAATCAAAGGG - Intergenic
944084672 2:195831815-195831837 TGATATACACATAAATAGAAAGG + Intronic
945553448 2:211249947-211249969 TTAGAAATCTATAAATTGAAAGG - Intergenic
945828713 2:214756990-214757012 TAATAAATAAATAAATTAAAAGG + Intronic
945974759 2:216261632-216261654 TGATAGAAATCTAACTAGAAGGG + Intronic
947025597 2:225734445-225734467 TGATGGATAGATAAATAGATAGG + Intergenic
947037684 2:225877888-225877910 AGATAGAAATATGAATTAAAAGG + Intergenic
947258364 2:228191581-228191603 TGATAGTCATAAAACTTGAAGGG + Intergenic
947299379 2:228671828-228671850 AGATAGATAGATAAAGTGATTGG + Intergenic
947310349 2:228795146-228795168 TGATAGATTTACAATTAGAAGGG - Intergenic
947494809 2:230627284-230627306 AGATAGATAGATAGATAGAATGG + Intergenic
1170290090 20:14759840-14759862 TGATATATTTATAAAAAGAAGGG - Intronic
1170328773 20:15184839-15184861 TTAAACATATATTAATTGAATGG - Intronic
1170555430 20:17511112-17511134 TGATATATATATATATAGACTGG - Intronic
1173368084 20:42406633-42406655 TGTTGGATATATAAAATGAATGG - Intronic
1173378145 20:42508628-42508650 TGATAGATAAATAAAAAGAGAGG + Intronic
1174964957 20:55202106-55202128 TGATAGATATATTAATTATCTGG + Intergenic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1175467454 20:59199058-59199080 AGATAGATATGTAAGTTGATGGG - Intronic
1176700623 21:10044721-10044743 TGATAGATAGATAGATAGATAGG - Intergenic
1177073505 21:16542569-16542591 TGTCAGATATAGAAATTGATAGG + Intergenic
1177251822 21:18602157-18602179 AGGAAGATATATAAATTGAAAGG + Intergenic
1177511795 21:22096214-22096236 AGATAGATATATCAGTTGATTGG - Intergenic
1178136190 21:29630168-29630190 AGATAGATAAATAAAATGGAGGG + Intronic
1179622808 21:42629421-42629443 TGATAGATAGATAGATAGATAGG + Intergenic
1180324604 22:11358481-11358503 TGAAACATATTTAAATAGAAAGG + Intergenic
1182038140 22:27215469-27215491 GGATTGATCTAAAAATTGAATGG - Intergenic
1182648761 22:31833211-31833233 TGATAAATATATGTTTTGAAAGG + Intronic
1182668401 22:31975391-31975413 TAATAAATAAATAAATGGAAAGG + Intergenic
1184625337 22:45723196-45723218 TGATAGAGATATATATAGATAGG + Intronic
1185053490 22:48565896-48565918 AGATAGATAGATGAATTGATAGG + Intronic
1185254359 22:49824180-49824202 TGGTAGAGATAGAAATTGAAGGG - Exonic
949154889 3:816110-816132 TGATAGCAATAAAAAGTGAAAGG - Intergenic
949168931 3:975328-975350 AAATAAATATATAAAATGAACGG + Intergenic
951018023 3:17750829-17750851 TGATAGATATATAAATTGAATGG - Intronic
951018024 3:17750858-17750880 ATATAGATACATAAATTGAATGG - Intronic
951107629 3:18763581-18763603 TGATTGAAATTTAAATGGAACGG - Intergenic
951609431 3:24475551-24475573 AGATAGATATAAAATCTGAAAGG + Intronic
951778547 3:26337554-26337576 TAAGAGATATGTATATTGAAGGG - Intergenic
952252478 3:31667954-31667976 GCATAGATATACAAACTGAATGG + Intronic
952628984 3:35441932-35441954 TGTAAGACATATAAATAGAATGG + Intergenic
954120234 3:48493891-48493913 TGAAATATGTATATATTGAATGG + Intronic
954485071 3:50840942-50840964 TGATAGCTAAATTAATTGAGAGG - Intronic
955154292 3:56401437-56401459 TGATAGAAATAAATATTGATTGG - Intronic
955170146 3:56556007-56556029 TGGTATATATATACATAGAATGG + Intergenic
955900052 3:63743535-63743557 TCAAAGATACATTAATTGAAAGG + Intergenic
956235850 3:67070083-67070105 TGAAAAATGTATAGATTGAAGGG - Intergenic
956889976 3:73603482-73603504 AGATGGATTTATAAATTAAATGG + Intronic
956933951 3:74078440-74078462 TGATAGAAAAATATTTTGAATGG - Intergenic
956955826 3:74338575-74338597 TAATACATATATAAAGTGATGGG - Intronic
957265122 3:77953553-77953575 TCATAAATATATAAATCAAATGG - Intergenic
957463005 3:80546856-80546878 TAATAGGTATATAAATTTATGGG + Intergenic
957512980 3:81213926-81213948 GAATAAATATATGAATTGAACGG - Intergenic
957667850 3:83258229-83258251 ATATATATATATAACTTGAAAGG + Intergenic
957676254 3:83369823-83369845 AAATAGATATATCAATTAAATGG + Intergenic
957785149 3:84873174-84873196 TGATAGATAGATAGATAGATAGG - Intergenic
958506805 3:94989539-94989561 TCAAAGTTATATAAATTAAAGGG + Intergenic
959253836 3:103984907-103984929 TGAGATATAAACAAATTGAATGG + Intergenic
959284050 3:104384282-104384304 TTATATATATATAACTTGGAGGG + Intergenic
959336672 3:105075769-105075791 TGACAGATAGATAAATACAAAGG + Intergenic
959927126 3:111935525-111935547 AGATAGATAGATAGATAGAAGGG + Intronic
960114211 3:113877369-113877391 GGATAGTTATGGAAATTGAATGG - Intronic
960292921 3:115908218-115908240 TTATATATATATAAACTGAGGGG - Intronic
960335535 3:116413039-116413061 TGTTAGATATATAAATTATTGGG + Intronic
960376667 3:116910725-116910747 TGATTTATATCTAAAATGAATGG - Intronic
960779012 3:121296694-121296716 TGATAGATAGACAGACTGAAAGG + Intronic
961564816 3:127755762-127755784 TGATAAATACATCAATTTAAGGG - Intronic
961915261 3:130367740-130367762 GGATATATATATAAATTATAAGG + Intronic
962586720 3:136849312-136849334 TAAAATATATATAAATTAAATGG - Intronic
962991422 3:140580827-140580849 TAATAGCTAAATAACTTGAATGG + Intergenic
963495820 3:146059382-146059404 TGAAAGATATCTAAAGTCAAAGG + Intergenic
963671794 3:148259996-148260018 TGAAAGACATAAGAATTGAAAGG - Intergenic
963831150 3:150010943-150010965 GGATAGATAGATAAATATAAAGG - Intronic
964146851 3:153474059-153474081 TTATAGATATATATATATAAAGG - Intergenic
964351914 3:155811447-155811469 TAATAAAGATATAATTTGAATGG + Intergenic
964778307 3:160305585-160305607 TGAGAGATATATAAATGCCATGG + Intronic
965107888 3:164381304-164381326 TGATAGTTATATAAAAGTAAGGG + Intergenic
965117316 3:164507458-164507480 TGATATATATATGAAATGCATGG - Intergenic
965117606 3:164512405-164512427 TAATAGGTATATAAATTTATGGG + Intergenic
965219746 3:165913828-165913850 GGATAGATATATATATATAAAGG + Intergenic
965891280 3:173516997-173517019 TTAAAGATATATGAATAGAATGG - Intronic
966922803 3:184625087-184625109 TGAGAGGTATAGAAATTGAATGG + Intronic
967056996 3:185838148-185838170 AGATAGATACATAAATAGATAGG + Intergenic
967139709 3:186545846-186545868 TGATAGAAATACTAATTAAATGG + Intronic
967579190 3:191132012-191132034 TGATTGATATATACATTGATGGG + Intergenic
967614593 3:191549260-191549282 TGATAAAAATATGAATTTAAAGG + Intergenic
968713809 4:2139725-2139747 TGATAGATATTTAAATTATATGG + Intronic
968768736 4:2489499-2489521 TGTTAGATACGTAAATTGGAGGG + Intronic
969658909 4:8514951-8514973 TAACAAATAAATAAATTGAATGG - Intergenic
970131640 4:12877596-12877618 TGATAGCAATATTTATTGAAAGG - Intergenic
970329995 4:14971345-14971367 GGATAGACATATAAATCAAAAGG - Intergenic
970715414 4:18916451-18916473 TGACAGATAGATACATAGAATGG + Intergenic
971638229 4:29092353-29092375 AAATGGATATACAAATTGAAGGG + Intergenic
972118504 4:35669310-35669332 TGAGAGCTACAGAAATTGAATGG - Intergenic
972910967 4:43816620-43816642 TTATATATATATAAAATGAACGG - Intergenic
973898383 4:55440253-55440275 TGATGAATTTATAAATTGAGAGG - Intronic
974320662 4:60344897-60344919 AGACAGATTTATAAATTGACAGG + Intergenic
974430062 4:61785067-61785089 GGATAAATCTATAAATTGATAGG + Intronic
974668134 4:64992506-64992528 TGATAGAAAGATAAATGGTAAGG + Intergenic
974736642 4:65943546-65943568 TGATAAACATACAAATTAAAAGG + Intergenic
974924560 4:68281451-68281473 TGTAAAATATGTAAATTGAAGGG + Intergenic
975038753 4:69717850-69717872 TGAAAGTTATATTAATGGAATGG - Intergenic
975074564 4:70189337-70189359 TGATAAAAACATAAATTGACTGG + Intergenic
975332072 4:73127665-73127687 TGATAGTTAAGTAAAATGAATGG + Intronic
975355854 4:73402852-73402874 TGATAGATACATAGATAGATAGG - Intronic
975563317 4:75727337-75727359 TGTTGTATATATAAACTGAAAGG + Intronic
975948514 4:79738827-79738849 TGAAACATCTATAAATGGAAAGG - Intergenic
976113062 4:81697499-81697521 TCAGAGATATGTCAATTGAAAGG + Intronic
976246959 4:83013877-83013899 TGATGGTTAAATAAAATGAAGGG + Intergenic
976455566 4:85243187-85243209 GGATAGATATGTAAAGTAAAAGG - Intergenic
976683073 4:87778957-87778979 TGATAGGTATAAAAATTAAATGG - Intergenic
976814180 4:89127598-89127620 TGATAGAAACATAAATGTAATGG + Intergenic
976920111 4:90429805-90429827 TGGTAAATGTATAATTTGAATGG + Intronic
977434812 4:96980523-96980545 TGGTAGAAATATAAACTTAAAGG + Intergenic
977438298 4:97029675-97029697 TGACAAATATTTAAATTCAATGG + Intergenic
977486441 4:97653093-97653115 TGATAGATAGATAGATAGATAGG + Intronic
977649971 4:99458213-99458235 TCACAGATAAGTAAATTGAAGGG + Intergenic
978694582 4:111561752-111561774 TGATAAATATGTAAAGTGATAGG + Intergenic
979045785 4:115861410-115861432 TTATAGATGAATAAATTGGATGG - Intergenic
979943633 4:126796202-126796224 TGATAGATGTATATATACAATGG - Intergenic
980468414 4:133217395-133217417 TTAAATAAATATAAATTGAAAGG + Intergenic
980714178 4:136610835-136610857 GGAGAGAAATTTAAATTGAAAGG - Intergenic
981072469 4:140558322-140558344 AGACAGAAATTTAAATTGAATGG - Intergenic
981267806 4:142807217-142807239 GGATATATATATAAGTAGAAAGG + Intronic
981632318 4:146834325-146834347 TGATAGATTTAGAAATTGCCTGG - Intronic
981743855 4:148032612-148032634 AGATAGATGTATATATTGAAGGG + Intronic
981801343 4:148660677-148660699 TTATATATATATAAATTATATGG - Intergenic
981835351 4:149046688-149046710 TGATATATATATAAACTAATAGG - Intergenic
982627073 4:157780916-157780938 AGATAGATAGATAGATAGAAAGG + Intergenic
982975617 4:162055553-162055575 AGATAGATAGACAAATTGTAAGG + Intronic
984508404 4:180649944-180649966 GTATATATATATAAAATGAAAGG - Intergenic
984557925 4:181237686-181237708 TTCTAGATATATAAATTCCATGG + Intergenic
985846207 5:2351119-2351141 TGTTAAAGATCTAAATTGAATGG + Intergenic
985870589 5:2551879-2551901 GGATAGATAAATAAATTTCAGGG - Intergenic
986037455 5:3953805-3953827 GGATAGATATATACATGTAAAGG + Intergenic
986089179 5:4487034-4487056 TGAGAGCTATATAAATCAAATGG - Intergenic
986532713 5:8755825-8755847 AGATAGATACATAGATTGATAGG - Intergenic
986744927 5:10735512-10735534 TGAAACATATACAAAATGAATGG - Intronic
986783630 5:11090022-11090044 AGATAGATAGATAAATAAAATGG + Intronic
986851715 5:11820235-11820257 TGACAGATACATAAATGGCAGGG - Intronic
987429272 5:17812475-17812497 ATATAGATATATAAATAGGAAGG - Intergenic
987675547 5:21068662-21068684 TAATAGATAAATAAATAAAATGG - Intergenic
988108137 5:26775519-26775541 AGATAGATAAATAGATAGAAAGG - Intergenic
988187279 5:27883175-27883197 TAATATACATATAAATTTAAAGG + Intergenic
988361015 5:30236685-30236707 TTATAGTTATATTAATTCAAGGG + Intergenic
989142581 5:38216636-38216658 TGATACCTAGATAAATTAAAAGG + Intergenic
989251026 5:39315483-39315505 TGATGATCATATAAATTGAATGG + Intronic
989781845 5:45275884-45275906 TGCTAGATTTAAAGATTGAAAGG - Intronic
989782278 5:45282129-45282151 TGATATGTATATAAGTTTAATGG + Intronic
990299375 5:54435347-54435369 TGATATAAATATGAATAGAATGG - Intergenic
990655241 5:57947999-57948021 TGATAGCTTTATTAATTAAATGG - Intergenic
990738201 5:58887131-58887153 TGATAGATAAATAGATAGATAGG + Intergenic
991466493 5:66918822-66918844 TGAATGATATATATAATGAATGG + Intronic
991601972 5:68360480-68360502 TTATATATATATAAATTGCAGGG - Intergenic
992228687 5:74642253-74642275 TAAAAAATATATATATTGAAAGG - Intronic
993111430 5:83661808-83661830 ACGTAGTTATATAAATTGAATGG + Intronic
993557536 5:89359751-89359773 TGCTAAATATATAAATTGTTGGG - Intergenic
994099282 5:95876724-95876746 TGTTAGAAATATAAATTGTCAGG - Intergenic
994296567 5:98096460-98096482 TAATAGATATACAAAATGAAAGG - Intergenic
994679782 5:102871679-102871701 TTATATATATATAAAATAAAAGG - Intronic
994692827 5:103038887-103038909 AAATAAATAAATAAATTGAAAGG + Intergenic
994742628 5:103640562-103640584 TGAAAGATATATGAAATGAATGG + Intergenic
994866808 5:105283641-105283663 TAATAAATCTATAAATTAAAAGG + Intergenic
995127215 5:108590252-108590274 TGATAGATATATATACAAAAAGG - Intergenic
995213280 5:109565353-109565375 TGATTTTTATATAAAGTGAAAGG + Intergenic
995459415 5:112387287-112387309 TTATAGATACTTAAATTGATGGG - Intronic
995496150 5:112745851-112745873 TAATAGTTATTTAAAGTGAAAGG - Intronic
995718307 5:115102545-115102567 GGATAGATATATAGATATAAAGG + Intergenic
996197585 5:120628666-120628688 TGATAGATAGATAGATAGATAGG - Intronic
996437858 5:123455388-123455410 ATATATATATATAAATGGAAAGG + Intergenic
996996886 5:129707509-129707531 TCATAGAAGTATAAAATGAAGGG - Intronic
998742725 5:145223268-145223290 TGATAGATACAAAAATAGAAAGG - Intergenic
998982708 5:147721876-147721898 TGAAAGAAATATAATTTTAAGGG - Intronic
999445662 5:151636751-151636773 TGAGATATATATAGAGTGAAGGG - Intergenic
999486273 5:151999479-151999501 TTATTCATATACAAATTGAAAGG - Intergenic
999886275 5:155926503-155926525 AAATAGATATATAAAGTAAAAGG + Intronic
1000004349 5:157169358-157169380 TGATAAACCAATAAATTGAATGG + Intronic
1000824747 5:166031239-166031261 AGATAGATAGATAGATAGAATGG + Intergenic
1001068492 5:168560716-168560738 TGATATTTATAAAAATTAAACGG + Intronic
1001270678 5:170309412-170309434 TTATAAATATATAAAATGATGGG + Intergenic
1002974679 6:2062287-2062309 AGATAGATCTATTTATTGAAGGG - Intronic
1003267892 6:4582473-4582495 TGGTAGCAATATAAAATGAATGG - Intergenic
1005160820 6:22861058-22861080 TGATTGATTTGTAAATTCAAGGG - Intergenic
1007883317 6:45192123-45192145 TCCTAGAAATCTAAATTGAAGGG - Intronic
1008058948 6:46976568-46976590 TGGTATATATATATATAGAAAGG + Intergenic
1008887087 6:56443352-56443374 TGATAGAGATAGAAAGTAAATGG + Intergenic
1009761451 6:68012113-68012135 TGATACATCTGGAAATTGAAAGG + Intergenic
1009889134 6:69658827-69658849 GGATAGATATAGAAATAGAGGGG + Intergenic
1010335582 6:74679111-74679133 AGATAGATAGATAAATAGATAGG + Intergenic
1010963759 6:82178433-82178455 TCTTAGATATATCAATTTAAAGG - Intronic
1011907030 6:92384025-92384047 CAAAAGATATATAAATAGAAGGG + Intergenic
1012011800 6:93797388-93797410 TGATACATGTATACATTGTAGGG - Intergenic
1012406664 6:98908589-98908611 TTATGGATATATAAATTGATGGG - Intronic
1012877787 6:104749467-104749489 TGATACATATGTAAAATTAAAGG + Intronic
1012920346 6:105216199-105216221 AGATAGATATATGTATTTAAAGG + Intergenic
1013006915 6:106082328-106082350 TGATAAAAATATAATTAGAAGGG + Intergenic
1013261532 6:108448847-108448869 TGAGAAGTATATAAATTCAAAGG + Intronic
1013491274 6:110648223-110648245 TTAAAGGTATATAGATTGAAGGG + Intronic
1013706150 6:112836935-112836957 TAAGAGATATATAAATTGGAAGG - Intergenic
1014062144 6:117083734-117083756 TGATAGAGATGTAAATTAACTGG + Intergenic
1015022957 6:128498769-128498791 AGATAGATAAATAGAATGAATGG + Intronic
1015065307 6:129019247-129019269 GAATAAGTATATAAATTGAATGG - Intronic
1015504871 6:133973491-133973513 GGAAAGATATTTAAACTGAAAGG - Intronic
1015599078 6:134894898-134894920 TTATAAATTTATAAATAGAATGG + Intergenic
1016986615 6:149900287-149900309 GGATAGATATGTAAATTATATGG - Intergenic
1016987010 6:149903358-149903380 TGATATATACATAAATTATATGG + Intergenic
1018663028 6:166105746-166105768 AGATAGATATATAGATAGATTGG + Intergenic
1020067348 7:5198873-5198895 TGATAGATATGTTAATTAACTGG - Intronic
1020503305 7:8951435-8951457 AGATAAATATATAAATTCATGGG - Intergenic
1020515311 7:9110720-9110742 TGATAAGTGTAGAAATTGAAAGG + Intergenic
1021088907 7:16457619-16457641 AGACAGATGTCTAAATTGAATGG - Intergenic
1021194067 7:17654666-17654688 TGTTAGAAAAATAAATTCAACGG + Intergenic
1022135193 7:27440852-27440874 TTACAGATAAAGAAATTGAAAGG - Intergenic
1022997564 7:35773353-35773375 TCATATATATATGAATAGAATGG + Intergenic
1023826004 7:44009800-44009822 TAATAGATACAAAGATTGAAAGG - Exonic
1024317902 7:48038402-48038424 AGATAGATAGATAGATAGAAAGG + Intronic
1024434577 7:49335697-49335719 TGATAGATATATAGATACATAGG - Intergenic
1024515088 7:50242720-50242742 CGATAGAAATATAAAGTGAGAGG + Intergenic
1024575312 7:50758780-50758802 TGAGAAATATGTAAATAGAATGG + Intronic
1024756796 7:52542692-52542714 TGATAGATAGATAGATAGAGTGG + Intergenic
1025910257 7:65822887-65822909 CAATAAATAAATAAATTGAAGGG - Intergenic
1026089574 7:67288670-67288692 TAATAGATACAAAGATTGAAAGG - Intergenic
1026724709 7:72861838-72861860 TAATAGATACAAAGATTGAAAGG + Intergenic
1026746842 7:73020033-73020055 TAATAGATACAAAGATTGAAAGG + Intergenic
1026750494 7:73048176-73048198 TAATAGATACAAAGATTGAAAGG + Intergenic
1026754141 7:73076286-73076308 TAATAGATACAAAGATTGAAAGG + Intergenic
1026757792 7:73104322-73104344 TAATAGATACAAAGATTGAAAGG + Intergenic
1027032946 7:74904604-74904626 TAATAGATACAAAGATTGAAAGG + Intergenic
1027089611 7:75289165-75289187 TAATAGATACAAAGATTGAAAGG - Intergenic
1027093256 7:75317093-75317115 TAATAGATACAAAGATTGAAAGG - Intergenic
1027096899 7:75345060-75345082 TAATAGATACAAAGATTGAAAGG - Intergenic
1027119167 7:75503980-75504002 TAATAGATACAAAGATTGAAAGG - Intergenic
1027272658 7:76531627-76531649 TAATAGATACAAAGATTGAAAGG + Intergenic
1027322449 7:77022620-77022642 TAATAGATACAAAGATTGAAAGG + Intergenic
1027326107 7:77050705-77050727 TAATAGATACAAAGATTGAAAGG + Intergenic
1027849491 7:83431223-83431245 TGGTAGATAAATAATTTCAATGG + Intronic
1028444673 7:90907725-90907747 CAATAGATATATTAATTAAAAGG + Intronic
1028510937 7:91625511-91625533 TTATAGATACAGAAATTGAGTGG + Intergenic
1028746684 7:94335468-94335490 TGATACATCTATACATTGTAGGG - Intergenic
1028846409 7:95485831-95485853 TGATCCCTATATAAATAGAACGG + Intronic
1029104118 7:98160936-98160958 TGACAGAAATATAATTTGACAGG - Intronic
1029398007 7:100322049-100322071 TAATAGATACAAAGATTGAAAGG - Exonic
1029718327 7:102346054-102346076 TAATAGATACAAAGATTGAAAGG + Intergenic
1029754289 7:102563202-102563224 TAATAGATACAAAGATTGAAAGG - Intronic
1029772239 7:102662289-102662311 TAATAGATACAAAGATTGAAAGG - Intronic
1030074803 7:105727300-105727322 TGAAAGATACCTAAGTTGAATGG + Intronic
1030635160 7:111939828-111939850 TGCTAGGTTTATAAATTCAAAGG + Intronic
1030752461 7:113245575-113245597 TGATTGATAAATAAATAAAAAGG + Intergenic
1030938188 7:115612913-115612935 TGATAGGTCTCTAAACTGAATGG + Intergenic
1030961915 7:115933809-115933831 TGATACATATTTAAAATGATAGG + Intergenic
1031232478 7:119126312-119126334 TGTTTGTTTTATAAATTGAATGG + Intergenic
1031654043 7:124329456-124329478 CTATATATATATAAATTTAATGG - Intergenic
1032352213 7:131175190-131175212 AGATAGATAGATAGATAGAATGG + Intronic
1033374522 7:140744721-140744743 AGATACATACATTAATTGAAGGG + Intronic
1033718330 7:144026611-144026633 AGATAGATAGATAATTTGAGAGG - Intergenic
1034963508 7:155377221-155377243 TGAAAGATAAATAAAATGCACGG + Intergenic
1035517172 8:244651-244673 TGATAGATATGTTGAATGAATGG - Exonic
1035906989 8:3522885-3522907 TAATATATAAATATATTGAAAGG - Intronic
1036501751 8:9320506-9320528 TGAATCATATATAAATAGAAAGG + Intergenic
1036921003 8:12855307-12855329 TGATAGAAATGTAAAATGTATGG + Intergenic
1037276935 8:17190731-17190753 TAATAGATATATATATTTATGGG + Intronic
1037405353 8:18536779-18536801 TGATAGTTCTATATATTGATTGG - Intronic
1038076622 8:24082724-24082746 TGATAAATATATATATAGACAGG - Intergenic
1038081629 8:24143765-24143787 TGTTTGAAATATAAATTAAAAGG + Intergenic
1038963063 8:32543124-32543146 GGATAGAAATATAAAATAAATGG + Intronic
1039596380 8:38793588-38793610 TCATATATATATAACTTGATGGG - Intronic
1039634418 8:39147748-39147770 GGATAAATAAATAAAATGAAGGG - Intronic
1039850539 8:41361042-41361064 TGATAGACATGCAAATGGAAGGG + Intergenic
1040430311 8:47334442-47334464 TGATAGGTATATACATGTAAAGG + Intronic
1040776555 8:51050375-51050397 TGACAGAAATAGAAATTGAATGG - Intergenic
1040843124 8:51805463-51805485 TTATATATATATAAAATGAATGG + Intronic
1040914524 8:52555502-52555524 TAATGAATATATAAATTTAAAGG + Intronic
1041626135 8:60029094-60029116 TGAAATATATAAATATTGAAAGG - Intergenic
1041646757 8:60260876-60260898 TGAAAGTTAAATAACTTGAAAGG + Intronic
1042003270 8:64150920-64150942 AGATAGATAGATAGATTGGATGG + Intergenic
1042019431 8:64355276-64355298 TAATAGAGATAGAAGTTGAAAGG - Intergenic
1043211089 8:77518979-77519001 ATATATATATATAAATTAAAAGG + Intergenic
1043699173 8:83262440-83262462 TTAAAGATATTTAAATTTAAAGG + Intergenic
1043943789 8:86227284-86227306 TGATACATATATAAATAACAAGG + Intronic
1045532103 8:102994792-102994814 TGAAAGATGTAACAATTGAATGG + Intergenic
1045666257 8:104489023-104489045 TGTGAGATACATCAATTGAAGGG + Intergenic
1045762018 8:105620698-105620720 TGATTTTTATATAAATTGTAAGG + Intronic
1046230049 8:111343382-111343404 TGTTAGATTTATAAATTAGATGG - Intergenic
1047732157 8:127736645-127736667 TGATAAAAAAATAAATTAAAAGG - Intronic
1047809707 8:128395198-128395220 TGATAGATAGATAAGTAGATAGG + Intergenic
1048107773 8:131430046-131430068 TCAAAGATAAATAAATTAAAAGG - Intergenic
1050123038 9:2327543-2327565 AGATAGATAGATAAATTTTAAGG + Intergenic
1050798814 9:9582511-9582533 TGAGAGATAAATAAATTATATGG + Intronic
1051696892 9:19777897-19777919 TGATAAATATATTATTTAAAAGG + Intronic
1051841682 9:21404961-21404983 TATTAGATACATAATTTGAAAGG - Intergenic
1052002827 9:23307620-23307642 TGATAGATATAAAAAAGGACAGG + Intergenic
1052195943 9:25714925-25714947 TTTTAGAGATATAATTTGAAAGG - Intergenic
1052780529 9:32778117-32778139 TGCTAAACATATAAATTAAATGG + Intergenic
1053194476 9:36105761-36105783 TGAAATATATATAACTTTAAGGG + Intronic
1054856958 9:69910754-69910776 TGATAGATATATATATAAAAGGG - Intergenic
1055008004 9:71530896-71530918 TTATATATATATATATTTAAAGG + Intergenic
1055100208 9:72456417-72456439 TGATAAACATCCAAATTGAATGG + Intergenic
1055929520 9:81545417-81545439 ATATGGATCTATAAATTGAATGG - Intergenic
1056945060 9:90987631-90987653 TGATAAGTATATAAAATAAAGGG + Intergenic
1058888925 9:109344357-109344379 CGATAGGCATATAAATTTAATGG - Intergenic
1059416401 9:114165323-114165345 TGATGGATAGATAAATGGATGGG - Intronic
1060906298 9:127309503-127309525 TGACAGAAATACAAATAGAAAGG + Intronic
1062259342 9:135652527-135652549 GGATAGATATATACATATAAAGG + Intergenic
1185481926 X:453122-453144 GGATAGATAGATAAATAGACAGG - Intergenic
1185543712 X:925135-925157 AGATAGATAGATAGATAGAATGG + Intergenic
1185552662 X:996242-996264 GGATAGATAGATAGATTGATAGG - Intergenic
1185582367 X:1220484-1220506 ACATAGATAGATAGATTGAATGG + Intergenic
1185582415 X:1220852-1220874 AGATACATATATAGATAGAAAGG + Intergenic
1185629968 X:1508701-1508723 AGATAGATAGATAGATAGAATGG - Intronic
1185630001 X:1509158-1509180 AGATAGATAGATAGATAGAATGG - Intronic
1185835140 X:3338825-3338847 TGATAGATAGATACATAGATAGG + Intronic
1185918275 X:4060596-4060618 AGATAGATAGATAAATAGATAGG + Intergenic
1185950446 X:4426649-4426671 TGATAGATAGATAGATAGATAGG + Intergenic
1185978919 X:4754196-4754218 CGATAGATATATAGATAGATAGG + Intergenic
1186017199 X:5211325-5211347 TGATAGATAGATAAAGTATATGG + Intergenic
1186019839 X:5242023-5242045 TTATATAAACATAAATTGAACGG + Intergenic
1186121352 X:6365331-6365353 TGATAGATAGATAAACAGATAGG + Intergenic
1186197618 X:7125590-7125612 TGATACAGATAGAAATGGAAGGG - Intronic
1186869701 X:13758792-13758814 TGATAGATATATAAATATACAGG + Intronic
1187119959 X:16395558-16395580 TAGTAGGTATATATATTGAAGGG - Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188043012 X:25392243-25392265 ACATATATATACAAATTGAAAGG - Intergenic
1188139526 X:26531978-26532000 AAATAGAAATATCAATTGAATGG - Intergenic
1188139534 X:26532121-26532143 AAATAGAAATATCAATTGAATGG - Intergenic
1188326858 X:28815344-28815366 TGATAGATGTATACATTTTAGGG + Intronic
1188393863 X:29656057-29656079 TGATAGATTGATATATTGCATGG + Intronic
1189111173 X:38291135-38291157 ATATATATATATAAAATGAAGGG + Intronic
1189374590 X:40456889-40456911 AGATAGATATAGATATTTAAAGG - Intergenic
1189826450 X:44923365-44923387 TGATAAACATATAATTAGAATGG - Intronic
1189941185 X:46123138-46123160 AGATAGATAGATAAATAGACAGG + Intergenic
1192890255 X:75383046-75383068 TAAAAGATCTATAAACTGAAAGG + Intronic
1192972419 X:76247487-76247509 TGAAAGGTATCCAAATTGAAAGG - Intergenic
1193423178 X:81308658-81308680 TTACGGACATATAAATTGAAAGG - Intergenic
1194053539 X:89101895-89101917 TTTTAGATTCATAAATTGAAAGG - Intergenic
1194440741 X:93930410-93930432 AGATAGATATATAGATAGATAGG - Intergenic
1194896598 X:99449082-99449104 TGTTATATAGATATATTGAATGG - Intergenic
1195110419 X:101642443-101642465 TGGAATATATATAAAATGAATGG + Intergenic
1195270815 X:103228929-103228951 AGATAGATATATATATATAAAGG + Intergenic
1195329286 X:103783910-103783932 TTATAGATATATAAAATCAGTGG + Intronic
1196692057 X:118570493-118570515 TTGTAGATAAATAGATTGAAAGG + Intronic
1196978985 X:121190868-121190890 TGATAGAGATAGAAACTGCAGGG + Intergenic
1196993146 X:121349901-121349923 TGAAAGAAATGTACATTGAAAGG + Intergenic
1198073801 X:133175657-133175679 AAATAGATATATAAATTGAAGGG + Intergenic
1198328927 X:135603449-135603471 TGATACATATAGATAGTGAAGGG + Intergenic
1198328939 X:135603543-135603565 TGATACATATAGATAGTGAAGGG - Intergenic
1198337563 X:135681808-135681830 TGATACACATAGATATTGAAAGG - Intergenic
1198361575 X:135900787-135900809 TGATACATATAGATAATGAAGGG - Intronic
1199036897 X:143062683-143062705 TTATAAAGATAGAAATTGAAGGG - Intergenic
1199397620 X:147357976-147357998 TGATTTTTATATAAATTTAAAGG - Intergenic
1200174247 X:154101403-154101425 AGATAGATAGATAAAATAAAAGG + Intergenic
1200282370 X:154788026-154788048 TGATTGTTATATACATTGTAAGG - Intronic
1201241507 Y:11961338-11961360 AGATAGATAGATAGATAGAATGG - Intergenic
1201241720 Y:11963623-11963645 TGATAGATAAATAGATGTAATGG + Intergenic
1201281436 Y:12345994-12346016 TGATAGATAGATAGATAGATAGG - Intergenic
1201679755 Y:16631669-16631691 AGATAGATAGATAGATAGAATGG - Intergenic
1201714980 Y:17034474-17034496 GGATAGATATAAATATTAAAGGG - Intergenic
1201746908 Y:17386168-17386190 GGATAGATGTATATATTAAAGGG + Intergenic
1202043204 Y:20708797-20708819 TGATAGATGTATATATTTATGGG - Intergenic