ID: 951026620

View in Genome Browser
Species Human (GRCh38)
Location 3:17837873-17837895
Sequence ATGTGGGTAAAGAGGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951026612_951026620 29 Left 951026612 3:17837821-17837843 CCTGTGAGAGGCAAATACTTTTA 0: 1
1: 0
2: 2
3: 13
4: 251
Right 951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG 0: 1
1: 0
2: 1
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951026620 Original CRISPR ATGTGGGTAAAGAGGGCTGA AGG Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
901559346 1:10057926-10057948 ATGTAGGTAAAGAGAGGAGAAGG + Intronic
902802978 1:18841875-18841897 ATGTGGGAAAAGAGGACTCAGGG - Intronic
903474115 1:23607629-23607651 AGATGGGGAAAGAGGGCAGAAGG - Intronic
903799074 1:25953232-25953254 GTCTGGGGAACGAGGGCTGATGG + Intergenic
904593913 1:31631048-31631070 ATTTGGAGAAAGAGGGATGAGGG - Intronic
904986069 1:34549811-34549833 ATGTGGGCAAAGGGGCATGAAGG - Intergenic
905527299 1:38648659-38648681 ATCTGGCTTCAGAGGGCTGAGGG + Intergenic
906196392 1:43933137-43933159 AAGTGGGTACTGAGGGCTGAAGG - Intergenic
907877594 1:58508358-58508380 ATGTGGGGAAGGAGGGTTTAGGG - Intronic
908378532 1:63572192-63572214 ATGTGGGTAAAGAAGAGTGGTGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909790645 1:79673640-79673662 ATGTGAGGAAAGAGGGCAAATGG - Intergenic
910214408 1:84828673-84828695 ATGTGAGAAAAGAGGCCTGGAGG - Intronic
911051594 1:93676104-93676126 TTGTGAGGAAAGAGGGCTGCTGG - Intronic
911531611 1:99050237-99050259 ATGTCAGTACTGAGGGCTGAAGG - Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913237588 1:116798130-116798152 ATGTGGGAAAAGAGGGCTGTAGG + Intergenic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
915533865 1:156522149-156522171 ATGTGGGCAAAGAGCTCTGGAGG - Intergenic
916492066 1:165310721-165310743 GTGTGGGTACTGAGGGCTGCTGG + Intronic
917654473 1:177112520-177112542 ATATGGGTAATGAGGTCTGATGG + Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
921000179 1:211036166-211036188 ATGTGGGTAAACAGGAATTAGGG + Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
923266550 1:232319841-232319863 ATGTGGGGAGAGAGGGGTCATGG + Intergenic
923364401 1:233245487-233245509 ATGTGTGCAAGAAGGGCTGAGGG + Intronic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
1064710575 10:18119981-18120003 ATGTGGATAAAGAGGCCTCCAGG + Intergenic
1064997791 10:21311786-21311808 ATGAGGGTAAGAAGGACTGAAGG - Intergenic
1065117698 10:22498346-22498368 ATGGGGGTTGAGAGGGGTGAAGG + Intergenic
1065624102 10:27613241-27613263 ATGTGGGAAAATAGGACTTAGGG - Intergenic
1065958413 10:30713527-30713549 ATGTGGGAAAACAGGAATGAAGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1068335038 10:55623869-55623891 ATGTAGCTAAAGATGGCTCAAGG + Intronic
1070763175 10:79038154-79038176 ATCAGGGTAAAGAAGGCTCATGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072994202 10:100229054-100229076 ATGTGTGAGAAGAGGGCTGAAGG - Intronic
1073218290 10:101849101-101849123 AAGTGGGTACAGAGGCCTGCAGG + Intronic
1074256800 10:111811146-111811168 ATGTGGGGAAAGAGGCTTCATGG - Intergenic
1074397213 10:113108063-113108085 ATGGGGGCAAAGGGGGCTGGAGG - Intronic
1075485169 10:122815756-122815778 ATGTGGTTAATCAGGGATGAAGG - Intergenic
1077482496 11:2822482-2822504 AAGTGCGTAAAGAGAGCTAAAGG + Intronic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1087155262 11:94895695-94895717 ATCTGGGTAAAGAGCACTCAGGG + Intergenic
1088835061 11:113570808-113570830 ATGTATGTATAGAGGGCTGCTGG + Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092762001 12:11818903-11818925 ATGTGGGTAGGGTAGGCTGAGGG - Intronic
1094442958 12:30499823-30499845 GTGTGGTTAAAGATGGCTTAGGG - Intergenic
1094443055 12:30500675-30500697 GTGTGGTTAAAGATGGCTTAGGG - Intergenic
1094812449 12:34151689-34151711 ATGTTGGGAAGGAGGGCAGAGGG - Intergenic
1095269250 12:40197136-40197158 GTGTTGGGAAAGAGGGCAGAGGG - Intronic
1096845226 12:54402966-54402988 GTTTGGGTAAGTAGGGCTGACGG - Exonic
1097777028 12:63658892-63658914 ATGTGGGTGAAGAGAAATGAAGG + Intronic
1098109847 12:67110807-67110829 ATGTGGCTAAAGGGAGTTGAGGG + Intergenic
1098644160 12:72878268-72878290 ATGTTGGAAAAGAGCGCTAAAGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1101754819 12:107613235-107613257 AAGTGGAAAGAGAGGGCTGATGG - Intronic
1102746098 12:115250512-115250534 TTGGGGGTAGACAGGGCTGATGG - Intergenic
1104328666 12:127824088-127824110 ATGCAGGTAAACAGGACTGATGG - Intergenic
1106073941 13:26441292-26441314 ATGTGGGTAAAGAGGAGTATTGG + Intergenic
1108588513 13:51892072-51892094 AGGTGGGGAAACAGGGCTCAGGG + Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1110127350 13:71962949-71962971 ATGTAGGTACAGAGTGCTGGAGG + Intergenic
1112310380 13:98312895-98312917 ATTTGGCTAAAGAGGGCAGGAGG + Intronic
1114616783 14:24072678-24072700 ATGGGGCTGGAGAGGGCTGAAGG - Intronic
1115667165 14:35563450-35563472 ATGAGGGTAAAGATGGGGGATGG + Intronic
1116785882 14:49288385-49288407 CTGTGAGGAAAGAGGGCTCAGGG + Intergenic
1117099362 14:52331007-52331029 ATGTGTGTAAAGAGGTCAGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117819236 14:59630858-59630880 AGGAGGGGAAAAAGGGCTGACGG + Intronic
1118616620 14:67578434-67578456 GTTTGGGGAAAGAGTGCTGAAGG + Intronic
1119472235 14:74907307-74907329 ATGTGGGTGCAGAGGGCAGTAGG - Intronic
1120020385 14:79523704-79523726 ATTTGGGTAATGAAGGCTCAAGG + Intronic
1120079858 14:80203437-80203459 ATTTGAGTAAAGAGGCATGATGG + Intronic
1120109142 14:80532541-80532563 ATATGGAGACAGAGGGCTGAGGG + Intronic
1120792536 14:88598398-88598420 AAGTGGGGAAAGAAGGCTGGGGG + Intronic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121112574 14:91322220-91322242 CTGTGGGTACAGGGGGGTGATGG + Intronic
1121124841 14:91399365-91399387 ATGTGGGAATCCAGGGCTGAGGG - Intronic
1121795648 14:96733178-96733200 AGGTGGGTAAAGATGGCAGGAGG - Intergenic
1122262633 14:100531900-100531922 CTGTGGGGAAAGGGGGCTGAGGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1122794425 14:104198899-104198921 ATGAGGCTAAGGAAGGCTGAGGG - Intergenic
1122842243 14:104471678-104471700 ATGTGTGTGGAGAGTGCTGATGG - Intergenic
1125132173 15:36295804-36295826 ATCTGGATAAAGAGAACTGAAGG - Intergenic
1125762740 15:42108390-42108412 GAGTGGGGAAAGAGGTCTGAAGG - Intergenic
1126492782 15:49258232-49258254 AAGTGGGGAAAGAAGGGTGATGG + Intronic
1128234684 15:66059520-66059542 ACATGGGTAATGAGGGCTGCAGG - Intronic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128705652 15:69835945-69835967 AGGTGGCTAAAGAGCCCTGAGGG + Intergenic
1131046003 15:89316064-89316086 AAGTGGGTAAAGAGAGTGGATGG - Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133550371 16:6848615-6848637 ATGTGTGTAGAGAGAGATGATGG + Intronic
1134263289 16:12671381-12671403 ATGGTGGTAAAGAGGGGTAAGGG + Intronic
1134999890 16:18768193-18768215 ATGTGGGGAAGGAGGGCTTGAGG - Intergenic
1141817483 16:86422498-86422520 CTGAGGGTAAAGAGGTCTGGAGG + Intergenic
1142024449 16:87804947-87804969 ATGTGGAGAGAGAGGGCGGATGG + Intergenic
1144630848 17:16871667-16871689 ATGTGGGGAAAGAGCCCTGTGGG + Intergenic
1144650466 17:17003808-17003830 ATGTGGGGAAAGAGCCCTGTGGG - Intergenic
1145191873 17:20848978-20849000 ATGTGGCTAAAGATGGCTCAAGG + Intronic
1145402083 17:22549013-22549035 ATGTGGCTAAAGATGGCTCAAGG + Intergenic
1147156786 17:38548025-38548047 ATGAGGGCAGAGAGGGCTGGCGG - Intronic
1147257892 17:39192896-39192918 AAGTGGGGAAAGAGGCATGAAGG + Intronic
1147260730 17:39208592-39208614 ATGGGGGTGAAGAAGGTTGAAGG + Intergenic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1149288375 17:55191185-55191207 ATGTGGCTGGAGAGTGCTGAAGG + Intergenic
1150065647 17:62106800-62106822 GTCTGGGTAAAGAGGACTCATGG - Intergenic
1150384990 17:64751731-64751753 ATGAGGGAAAAAAGGGCTCATGG + Intergenic
1150503396 17:65673326-65673348 ATGTGGCAAAAGAGGGCGGGGGG - Intronic
1152022822 17:77789925-77789947 ATGTGGGAAGAGAGGGCCGATGG + Intergenic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1153206805 18:2711933-2711955 ATATGGCAAAAGAGGGGTGAGGG - Intronic
1153415966 18:4845984-4846006 ATGGGGTTAAAGAGAGCTGGGGG + Intergenic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1155080787 18:22407942-22407964 ATGTTTGTAAACAGGGCAGAGGG - Intergenic
1155775334 18:29754123-29754145 ATGTGGTTAAACAGGGCAGAGGG - Intergenic
1156375716 18:36513700-36513722 AAGAGGGGAAAGAGGGATGAAGG - Intronic
1156569365 18:38235527-38235549 ATGTGGATGGAGAGGGCTGATGG + Intergenic
1156888179 18:42159559-42159581 CTGTGGGGAAAGAAAGCTGAAGG + Intergenic
1158884666 18:61815839-61815861 CTGTGGCTGAAGAGGGCTGCAGG - Exonic
1159839643 18:73383795-73383817 ATGTGGGTAAGGAACTCTGATGG + Intergenic
1162325230 19:9995446-9995468 TAGTGGGAAAAGAGTGCTGAAGG - Intronic
1167139611 19:47640643-47640665 ATGGGGGCAGAGAGGGCTGGCGG + Intronic
1168135317 19:54347131-54347153 ACGTGGGTGAGGAGGGCTCAAGG + Intergenic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
1168467851 19:56618631-56618653 TTGTGGGGAAACAGGCCTGAAGG + Intronic
1168536729 19:57176997-57177019 GAGTGGGGAAAGAAGGCTGAAGG - Intergenic
925272269 2:2620328-2620350 ATGGGGATAAACAGGGCTGTGGG + Intergenic
927345492 2:22033880-22033902 ATGTGGGTAAAGAGAGGAGGGGG - Intergenic
927468694 2:23356241-23356263 ATGAGGATGATGAGGGCTGAGGG - Intergenic
928169613 2:28994950-28994972 ATGTGGGGATAAAGGGCTGCTGG + Intronic
928426016 2:31178405-31178427 AGGTGGATATAAAGGGCTGAAGG + Intronic
929866361 2:45720564-45720586 ATGTGGGCAAAGAGGGATACTGG - Intronic
932399533 2:71470306-71470328 ATGTAGGGAAAGTGGGCTGAAGG + Intronic
932895477 2:75635485-75635507 TCCTGGGTAAAGAGGGCTGAGGG - Intergenic
935637992 2:105264867-105264889 ATGAGGGGAAAAAGGTCTGATGG + Exonic
936270240 2:111043507-111043529 AGGTGGGAGGAGAGGGCTGAGGG + Intronic
941094570 2:161222082-161222104 ATGGGGATGAAGAGGGCTGAAGG - Intronic
942841641 2:180368991-180369013 ATGTGGGAAAAGAAGGCTGGAGG + Intergenic
943523941 2:188993276-188993298 ATGTGTTTAAACAGGACTGAAGG + Intronic
944085391 2:195841266-195841288 ATATGGGGAAAGAGGGTTGGGGG - Intronic
946117637 2:217477483-217477505 ATGAGGGGAAAGAGGGCTCCAGG + Intronic
946655554 2:221942099-221942121 ATGTGGGGAAAGAGTTTTGAAGG - Intergenic
947922318 2:233888061-233888083 ATGTGGGTAAATAGTGGTGAGGG - Intergenic
948353094 2:237356981-237357003 ATAAGGGGCAAGAGGGCTGAGGG - Intronic
1168761732 20:354220-354242 AGGTGGGTGAAGAAGGCTGGAGG + Exonic
1168812660 20:715858-715880 ATGTGGGGAAAGTGGGGAGAGGG + Intergenic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169923067 20:10755964-10755986 ATGTGGGGAATCTGGGCTGAAGG + Intergenic
1170029391 20:11929342-11929364 ATGAGGGGAAAGGGGGATGAAGG + Intergenic
1170346477 20:15392564-15392586 CTGTTGGTAAAGAGGCATGATGG - Intronic
1170436289 20:16333087-16333109 ATGTGGGCAAAGAGGTAGGAAGG - Intronic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1172489960 20:35328259-35328281 AGGTGGGGAAACAGGGCTGTTGG - Intronic
1172931675 20:38591050-38591072 AGGTGGGGCAAGAGGGCTGGGGG - Intergenic
1173373612 20:42462124-42462146 ATGTGGGCAATGAGAGCTGGAGG + Intronic
1173519848 20:43691122-43691144 AAGTGGCCAAAGAGGGCAGAAGG - Intronic
1174526390 20:51175317-51175339 TTGTGGGTGATGAGGGCTGCAGG + Intergenic
1179232299 21:39515776-39515798 ATGATGGTAAGGAGGGATGATGG + Intergenic
1179268781 21:39831647-39831669 ATGTGTGGAAACAGTGCTGAAGG - Intergenic
1179953799 21:44726946-44726968 AGGTGGGTCATGAGGGCTGTTGG - Intergenic
1181319305 22:21992196-21992218 AGGTGGGTACAGAGCCCTGAAGG - Intergenic
1182835071 22:33335207-33335229 ATGTGAGCAAAGAGAACTGAAGG + Intronic
1183581535 22:38729370-38729392 CTGTGGGAGAAGGGGGCTGAGGG + Intronic
1184643097 22:45882555-45882577 ATGTGTGTAAAGTGGGGTAATGG + Intergenic
1185275020 22:49947021-49947043 CTGTGGGTAAAGAAGCCTGCTGG - Intergenic
1185362632 22:50417766-50417788 ATGTGGGTGTTGTGGGCTGATGG + Intronic
949781810 3:7698152-7698174 ATGTATGTAAAGAGGACTGAAGG + Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951105682 3:18739370-18739392 ATGTGGGCAGAAAGGGCTTATGG - Intergenic
952116171 3:30184270-30184292 ATCTGGGGAGAGAGGCCTGAGGG - Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
953171443 3:40511319-40511341 GTGCGGGCAAAGATGGCTGAGGG + Intronic
953340825 3:42132830-42132852 ATGTGGGTACATGAGGCTGAGGG - Intronic
953529512 3:43727487-43727509 ATGTGGCCACAGAAGGCTGATGG - Intronic
954030582 3:47817269-47817291 ATATGGGTAAGGAAGGCTTAAGG - Intronic
959168687 3:102816396-102816418 ATCTTGGTAAAGAGGCTTGAGGG + Intergenic
961006521 3:123409374-123409396 ATGTGGGGAAAAAGGACAGACGG + Intronic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
962462565 3:135628165-135628187 ATATGGGCAAGGAAGGCTGATGG - Intergenic
964899303 3:161638579-161638601 ATGTGGCTGGAGAGGGATGATGG + Intergenic
965553303 3:169992693-169992715 ATGTGTGTACAGAGGCCTGAAGG - Exonic
967996761 3:195172816-195172838 ATTTGGGGAAAGAGGGCAAAGGG + Intronic
971013760 4:22466367-22466389 ACGTGGGTGAAGAGGGATGGAGG - Intronic
975922843 4:79413519-79413541 AGGTGGGAAAAGGGGGCTAAGGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977223777 4:94370507-94370529 GTGTGGGAAGAGATGGCTGAGGG - Intergenic
978855995 4:113395656-113395678 ATGTTGGGGAAGGGGGCTGATGG - Intergenic
978867000 4:113524913-113524935 ATGTGGGTAAGAATGGATGAAGG + Intronic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
982352557 4:154431778-154431800 CTGTATGTAAAGAAGGCTGAAGG - Intronic
984391458 4:179139220-179139242 ATGTTGGAATAGAGGGGTGATGG - Intergenic
985320188 4:188702104-188702126 ATGTGGTGGAAGAGGGCTTATGG + Intergenic
987095186 5:14543106-14543128 ATGTTGGTAATGAGGACTGCTGG + Intergenic
989113499 5:37929663-37929685 AGGTGGGAAAAGGGGGCTGGGGG + Intergenic
989191413 5:38673307-38673329 ATTTGGGGGAAGAGGGCTCAAGG + Intergenic
990021990 5:51139124-51139146 ATGTGGGTACAGAGGGCATGTGG + Intergenic
990312032 5:54549369-54549391 AGGTGGGCAAAGTGGGCAGAAGG - Intergenic
992496326 5:77297713-77297735 ATGTGGCTAGAGAGGGAGGAAGG - Intronic
993736482 5:91482747-91482769 ATCTGGGGGAAGAGGGCTCAGGG - Intergenic
994428331 5:99623366-99623388 AGGTGGGGAAAGATGGCTGGAGG - Intergenic
994846703 5:104997866-104997888 ATGTGTGAAATGAGGGCTTAGGG - Intergenic
995106199 5:108380893-108380915 AGGTGGGAGAAGAGGGCGGAGGG + Exonic
995110162 5:108420045-108420067 ATGTGGATGAAGAGGACTAAGGG - Intergenic
995284775 5:110375468-110375490 ATTTGGGTAAAGAGTGTTGCTGG - Intronic
998159217 5:139803707-139803729 AAGTGGGTTAAGAGGGTTTAGGG + Intronic
998370113 5:141655484-141655506 ATGGGGGTGAAGAAGGCAGAAGG + Intronic
999457186 5:151726683-151726705 ATGTGTGTAAAGATGGCTCATGG + Intergenic
1000071522 5:157744370-157744392 ATGTGGGTAATGAGGGCGTGGGG + Intronic
1000524657 5:162341709-162341731 ATGTGAGTAAAAAGGGCTGCAGG - Intergenic
1001184914 5:169561095-169561117 TTGAGGGCCAAGAGGGCTGAGGG + Intergenic
1001413381 5:171526403-171526425 ATGAGGTCAAAGAGGGCTCAAGG + Intergenic
1001460003 5:171903525-171903547 ATGTGATAAAAGAAGGCTGACGG - Intronic
1001535982 5:172498132-172498154 CTGCGGCTAGAGAGGGCTGAGGG - Intergenic
1001683961 5:173578578-173578600 ATGGGGGTGAAGAGTGCTCAAGG - Intergenic
1003372184 6:5539137-5539159 ATGGGGGAAAGGAAGGCTGATGG - Intronic
1003586188 6:7391038-7391060 GTCTGGGGAAAGAGGGATGAAGG + Intronic
1005317001 6:24612768-24612790 ATGAGGGGAGAGAGGGCTCAGGG + Intronic
1007122864 6:39397819-39397841 AGGTGTGTAAGAAGGGCTGATGG + Intronic
1008302070 6:49853504-49853526 GTGAGGATAAAGAGGACTGAAGG - Intronic
1013551216 6:111209600-111209622 CTGTGGGTTAAGAGGCCTGTGGG + Intronic
1013768528 6:113600648-113600670 ATGTTGGAGAAGAGGCCTGATGG + Intergenic
1017523400 6:155221764-155221786 ATCTGGAAATAGAGGGCTGAGGG - Intronic
1017628369 6:156370976-156370998 CTATGGATACAGAGGGCTGATGG - Intergenic
1018033530 6:159863071-159863093 ATGAGGGTACTGTGGGCTGAAGG - Intergenic
1018702681 6:166439651-166439673 ATGTGGGTGAGGGGGGCTGCTGG + Intronic
1018741689 6:166733951-166733973 GTGTGGGAACAGAGGACTGAGGG + Intronic
1021458267 7:20855240-20855262 ATGCGGCAAAGGAGGGCTGAGGG + Intergenic
1022361387 7:29662880-29662902 ATGTGGGCAAAGAGAGACGAAGG - Intergenic
1022935942 7:35176556-35176578 ATGTGGGCAAAGAGAGATGAAGG + Intergenic
1023130795 7:37000845-37000867 ATGTGGGTTAAGCAGGCTTAAGG + Intronic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1025766896 7:64464167-64464189 TTATGGCTAAAGGGGGCTGAGGG - Intergenic
1028905871 7:96153490-96153512 ATGTGTTTAAACAGGGCTTAGGG + Intronic
1028971482 7:96863558-96863580 ATGGGATTAGAGAGGGCTGATGG + Intergenic
1029745434 7:102513424-102513446 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1029763373 7:102612403-102612425 ATCTGGGGAAAGAGGGATGGGGG + Intronic
1030797987 7:113813595-113813617 ATGTGTGTGAAGAGTGTTGAGGG - Intergenic
1032637374 7:133724664-133724686 ATGAAGGTAAAGTGGACTGAAGG + Intronic
1032984066 7:137317431-137317453 ATGTGGGTAAAGAGTGTGGGAGG + Intronic
1033041087 7:137918883-137918905 ATGTTTGTAAAGAGGGCTATAGG - Intronic
1033247165 7:139727322-139727344 CTGTGGGAAAAGAGGGCTATTGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035938452 8:3868728-3868750 ATGTGGGTTGAGAGAGCAGAGGG - Intronic
1037017169 8:13923408-13923430 ATGTGGGAACAGAGGGCATAAGG - Intergenic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1039748544 8:40455662-40455684 AGCTGGGTAAAGAGAGCTGCAGG - Intergenic
1039875198 8:41578615-41578637 ATGTGGGTGGCGAGGGCTGCTGG + Intronic
1040290718 8:46122690-46122712 ATGTGGGAAAAAGGGGCTGCAGG - Intergenic
1040506614 8:48054484-48054506 ATGTGTGTATAGAGGGTTGTGGG + Intronic
1041695006 8:60726834-60726856 AGGTGGGTGCAGATGGCTGAAGG - Intronic
1042144831 8:65716884-65716906 GTGTGGGTATAGAGGTCTGAGGG - Intronic
1044112169 8:88288449-88288471 ATGAGGTTAAATAGGGCTCAGGG - Intronic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1044847068 8:96392468-96392490 AGGTGGGAACAGAGGGGTGAAGG - Intergenic
1046150736 8:110221237-110221259 GTGTGGGTAAAGAAAGCAGAGGG - Intergenic
1047688612 8:127327792-127327814 ATTTGGGTAAAGAGGATTCAAGG + Intergenic
1048512136 8:135072435-135072457 ATGTGGGTAAACAGGAAGGAGGG + Intergenic
1048672736 8:136741131-136741153 ATGTAGGTCAATATGGCTGAAGG + Intergenic
1049675958 8:143889196-143889218 GTGTGGCTTCAGAGGGCTGAGGG + Intergenic
1051505984 9:17828310-17828332 AGGTGGGAAAGGAGGGCTGTAGG - Intergenic
1052142109 9:24999751-24999773 ATATGGAGAATGAGGGCTGATGG - Intergenic
1052177023 9:25474364-25474386 ATGTGGGTAAACAGGAATTAGGG - Intergenic
1052560767 9:30079822-30079844 ATGTGGGAAAAGAGGTCTTGAGG + Intergenic
1054815974 9:69475945-69475967 ATGTGGGTCAGGAGCGCTGTAGG + Intronic
1059504164 9:114782750-114782772 ATGAGGGAAATGAGGTCTGAGGG - Intergenic
1059729563 9:117043493-117043515 GTCTGGGGAAAGAAGGCTGAGGG + Intronic
1060217120 9:121745093-121745115 ATGTGGGGGAAAAGGGCAGACGG + Intronic
1060710288 9:125856493-125856515 ATCGGGGTAATGAGGGCTAACGG + Intronic
1062030223 9:134358837-134358859 ATGTGGGTGGTGAGGGCTGTGGG + Intronic
1188182909 X:27077247-27077269 ATGTGGGTAAACAGGAATTAGGG - Intergenic
1188411550 X:29878170-29878192 GTGTGGGTTAAGAGGTCTCAGGG + Intronic
1189407591 X:40739047-40739069 ATGTGGGTAAACAGGAATTAGGG - Intergenic
1190123047 X:47679306-47679328 AATTGGGTATAGAGGGATGAGGG + Intergenic
1190430907 X:50377015-50377037 ATGTGGGTACAGTGGGTAGAGGG + Intronic
1190434579 X:50410791-50410813 AAGTGGGAAAAGAGAGTTGAAGG + Intronic
1190881752 X:54496350-54496372 CTGTGGGGAAAGCAGGCTGAGGG - Intergenic
1198495058 X:137183954-137183976 ATGTGTGTATAGAGGGGTGGTGG - Intergenic
1199334939 X:146607523-146607545 AAGTGGGGAGAGTGGGCTGAGGG + Intergenic