ID: 951029399

View in Genome Browser
Species Human (GRCh38)
Location 3:17864124-17864146
Sequence AGGGAGAGCACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 837
Summary {0: 10, 1: 58, 2: 101, 3: 188, 4: 480}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951029399_951029410 28 Left 951029399 3:17864124-17864146 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 951029410 3:17864175-17864197 TGCGGCTGCTACTGGGAGATGGG 0: 1
1: 0
2: 0
3: 21
4: 154
951029399_951029405 10 Left 951029399 3:17864124-17864146 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 951029405 3:17864157-17864179 CAAAGATTCTCTATGCCGTGCGG 0: 1
1: 0
2: 3
3: 13
4: 65
951029399_951029411 29 Left 951029399 3:17864124-17864146 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 951029411 3:17864176-17864198 GCGGCTGCTACTGGGAGATGGGG 0: 1
1: 0
2: 3
3: 20
4: 326
951029399_951029406 20 Left 951029399 3:17864124-17864146 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 951029406 3:17864167-17864189 CTATGCCGTGCGGCTGCTACTGG 0: 1
1: 0
2: 0
3: 3
4: 63
951029399_951029412 30 Left 951029399 3:17864124-17864146 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 951029412 3:17864177-17864199 CGGCTGCTACTGGGAGATGGGGG 0: 1
1: 1
2: 4
3: 31
4: 337
951029399_951029407 21 Left 951029399 3:17864124-17864146 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 951029407 3:17864168-17864190 TATGCCGTGCGGCTGCTACTGGG 0: 1
1: 0
2: 0
3: 2
4: 57
951029399_951029409 27 Left 951029399 3:17864124-17864146 CCCACAGTCACTGTGCTCTCCCT 0: 10
1: 58
2: 101
3: 188
4: 480
Right 951029409 3:17864174-17864196 GTGCGGCTGCTACTGGGAGATGG 0: 1
1: 0
2: 0
3: 17
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951029399 Original CRISPR AGGGAGAGCACAGTGACTGT GGG (reversed) Intronic