ID: 951030679

View in Genome Browser
Species Human (GRCh38)
Location 3:17878084-17878106
Sequence CAATTCTTTCAGACTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 6, 1: 0, 2: 3, 3: 18, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951030674_951030679 23 Left 951030674 3:17878038-17878060 CCACTGACTGCTGGAGGATGCGC 0: 5
1: 0
2: 1
3: 7
4: 103
Right 951030679 3:17878084-17878106 CAATTCTTTCAGACTTTCCTTGG 0: 6
1: 0
2: 3
3: 18
4: 273
951030675_951030679 -4 Left 951030675 3:17878065-17878087 CCTCTTCCACCTCATTTTCCAAT 0: 1
1: 0
2: 5
3: 53
4: 654
Right 951030679 3:17878084-17878106 CAATTCTTTCAGACTTTCCTTGG 0: 6
1: 0
2: 3
3: 18
4: 273
951030676_951030679 -10 Left 951030676 3:17878071-17878093 CCACCTCATTTTCCAATTCTTTC 0: 1
1: 0
2: 9
3: 47
4: 699
Right 951030679 3:17878084-17878106 CAATTCTTTCAGACTTTCCTTGG 0: 6
1: 0
2: 3
3: 18
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951030679 Original CRISPR CAATTCTTTCAGACTTTCCT TGG Intronic
902398967 1:16147200-16147222 CAATTCATTCAGACTCTCCTTGG - Intronic
904232680 1:29089568-29089590 CATTTCTTCTAGATTTTCCTTGG - Intronic
904877257 1:33665413-33665435 CAAAACTTTAATACTTTCCTGGG + Intronic
906540993 1:46585923-46585945 CAAATGGTTAAGACTTTCCTTGG + Intronic
908606437 1:65802221-65802243 CAATTCCTTCATAGTTTCCTCGG - Intronic
909267030 1:73573412-73573434 CAATTATTTCACAGTTTCCATGG + Intergenic
909819721 1:80046761-80046783 GAATTCTGTCAGAATTTCCTTGG + Intergenic
910447454 1:87313137-87313159 CATTTCTTTCCCACTTTTCTGGG + Intergenic
911336787 1:96590968-96590990 AAATCCTTTGAGACTTTCCAGGG + Intergenic
912147990 1:106817900-106817922 CAATTCTTTTAGTTTTTACTAGG - Intergenic
912269973 1:108199415-108199437 CCATTGTTTAAGACATTCCTAGG - Intronic
913429285 1:118772344-118772366 GAATTCTATCAGACATTCCAAGG + Intergenic
913845381 1:123501706-123501728 GAAATCTTTCAGGCTTTCGTTGG + Intergenic
917214797 1:172667000-172667022 CAAATCTTTCTGCCTTTGCTAGG + Intergenic
917231497 1:172842609-172842631 CAATTGTTTCAGAATCTTCTGGG - Intergenic
917593697 1:176505220-176505242 CAATTCTTTCAACCCTTCCAAGG + Intronic
918384635 1:183993414-183993436 TAATTCTTTCTGGCTTTCATTGG + Intronic
918576870 1:186071821-186071843 CAATTCTTTATGAGTTTACTTGG + Intronic
918906393 1:190500995-190501017 CAACTTTTTCACTCTTTCCTTGG - Intergenic
918965765 1:191345244-191345266 TAATTTTCTCAGACTTTACTAGG - Intergenic
919107716 1:193174612-193174634 CAATCCTTTCATACATTGCTTGG + Intronic
919415626 1:197305016-197305038 CTATTCTTTCAGCCATTCCAGGG + Intronic
923569043 1:235098267-235098289 TAATTATTTCAGTCTTTCATTGG - Intergenic
924559722 1:245147691-245147713 CAAGTGTTTGAGACTATCCTGGG + Intergenic
1063963540 10:11327022-11327044 CCATGCCTTCAGACCTTCCTGGG - Intronic
1064184387 10:13148235-13148257 CTATTCTTTCCTAGTTTCCTAGG - Intergenic
1064364735 10:14697332-14697354 CAGTTCCTTCAGATTTTCCATGG + Intronic
1064743768 10:18459401-18459423 CCATTCTTTCAGAGTTTCATGGG + Intronic
1067998396 10:51302467-51302489 ATATTTTTTCATACTTTCCTAGG - Intronic
1069609679 10:69764475-69764497 TAAATCCTTCAGAATTTCCTGGG - Intergenic
1069637563 10:69935090-69935112 CTATTCTTCCAGATTTTTCTTGG - Intronic
1071757987 10:88567181-88567203 CTTTTCTTTCTGTCTTTCCTGGG - Intronic
1075582252 10:123629732-123629754 CAATTCATTCAGAATTGCCATGG - Intergenic
1077671547 11:4162253-4162275 CAATTATATTAGAGTTTCCTGGG - Intergenic
1078598837 11:12713226-12713248 CAAGTGTTTGAGACTATCCTGGG - Intronic
1079238709 11:18707203-18707225 CAACTCTTCCAGATTTCCCTCGG - Exonic
1079975241 11:27083070-27083092 CAATACTTTCAGAGTTTTATGGG + Intronic
1080233299 11:30042205-30042227 CAGGTCCTTCAGACATTCCTGGG - Intergenic
1081943527 11:46966339-46966361 CGATTCTTAAAGACTTTTCTGGG - Intronic
1086861666 11:91931952-91931974 CAAATCACTCAGACTTTTCTGGG - Intergenic
1087247603 11:95857882-95857904 TATTTCTTTCAGATTATCCTTGG + Intronic
1087436636 11:98127324-98127346 CAATTCTTTCTGTCATGCCTGGG + Intergenic
1087615699 11:100484477-100484499 CAAGTTTCTCAGTCTTTCCTTGG - Intergenic
1088866950 11:113857230-113857252 CAATTCTTTCACATATTTCTCGG + Intronic
1091524326 12:1282647-1282669 AAATTCTATCATCCTTTCCTAGG - Intronic
1093654805 12:21682257-21682279 CATTGCTTTCACACTTACCTGGG + Intronic
1093784501 12:23176629-23176651 CAATACTTCCAGCATTTCCTGGG + Intergenic
1093904185 12:24670620-24670642 CAATTCTTTCAGCCTTAGTTGGG + Intergenic
1094483579 12:30905459-30905481 AACTTCTTTCAAACTTCCCTTGG - Intergenic
1095030380 12:37267049-37267071 CAACTCTTTGAGACCTTCGTTGG - Intergenic
1095912462 12:47442606-47442628 CCATTCTTTCAGAGTTTCTTGGG + Intergenic
1098033274 12:66276563-66276585 CAATTCTTTCAGACTTTCCTTGG + Intergenic
1098788822 12:74794234-74794256 CAATTCATTAAGATATTCCTTGG + Intergenic
1099782477 12:87215276-87215298 GATTTCTTCCAGACATTCCTAGG + Intergenic
1099885163 12:88520289-88520311 CAAAGCTGTCAGTCTTTCCTTGG + Intronic
1101300050 12:103470223-103470245 CAATGCTTTCACACTGTCCGAGG + Intronic
1101394814 12:104337559-104337581 AAATGTTTTCAGACTTTGCTGGG + Intronic
1101833582 12:108278746-108278768 TATTTCTTTCAAACTTTGCTTGG + Intergenic
1102735475 12:115155418-115155440 CAAATTGTTCAGACTTTCCCAGG - Intergenic
1102796486 12:115693246-115693268 CCATTCTCTCAGCCCTTCCTGGG + Intergenic
1104706341 12:130950389-130950411 AAAATATTTCAGACTTTACTGGG - Intergenic
1105046076 12:133004691-133004713 CAAGAGTTTCAGACTATCCTGGG - Intronic
1106309051 13:28537083-28537105 CATTTTTTTCATTCTTTCCTAGG + Intergenic
1106783619 13:33085817-33085839 CAAATCTTCCAGACTTTTCGGGG + Intergenic
1107058803 13:36133299-36133321 CAATACTTTCAGATGATCCTGGG - Intergenic
1108227675 13:48305451-48305473 CAATTCTTGCAAATTTCCCTTGG + Intronic
1109490402 13:63090402-63090424 CCATTTGTTCAGACTCTCCTTGG - Intergenic
1111578110 13:90185061-90185083 GACTTCTTTAAGACTTTTCTTGG + Intergenic
1114728646 14:24966681-24966703 AAATTTTTTTAGAGTTTCCTTGG - Intronic
1114744617 14:25134360-25134382 CAGTAGTTTCTGACTTTCCTGGG + Intergenic
1114943791 14:27651869-27651891 CAATTATTTCAGATTTGCTTGGG - Intergenic
1115061045 14:29190583-29190605 CAGTTCTTTCATACCTGCCTTGG + Intergenic
1115438164 14:33400853-33400875 CAAGTATTTCAGACCTACCTAGG + Intronic
1115642084 14:35341438-35341460 CAAATCTTAGGGACTTTCCTGGG - Intergenic
1116154232 14:41183546-41183568 CATTTCTAAAAGACTTTCCTAGG + Intergenic
1116994604 14:51309507-51309529 CAATTCTTCCAGGTTTGCCTGGG - Intergenic
1117557546 14:56901509-56901531 CAATGTTTTCACATTTTCCTAGG + Intergenic
1119721315 14:76892667-76892689 CAAGTCTTTCATATCTTCCTGGG - Intergenic
1122035157 14:98943612-98943634 AAATTTTTTCACTCTTTCCTTGG + Intergenic
1123103511 14:105822718-105822740 AAATTCTTTGAGGCTTTCCAGGG + Intergenic
1125206305 15:37157423-37157445 GAATACTTTCATACATTCCTAGG - Intergenic
1125749049 15:42016311-42016333 TGGTCCTTTCAGACTTTCCTGGG + Intronic
1126249691 15:46553077-46553099 ATATCCTTTAAGACTTTCCTTGG - Intergenic
1128593529 15:68924297-68924319 CTATACTTTCAGACTTTCACAGG + Intronic
1129545165 15:76388159-76388181 CAATTCCTTCAAATATTCCTTGG - Intronic
1130923994 15:88371605-88371627 CAACTCCTTAAGACTTTCCAAGG + Intergenic
1132369294 15:101282774-101282796 CAGTACTTTAAGACTTTTCTGGG - Intronic
1133635332 16:7659514-7659536 CAATTCTTTCAGTGTGTCCCAGG - Intronic
1134175704 16:12004385-12004407 CAATGATGTCAGCCTTTCCTGGG - Intronic
1135673093 16:24391535-24391557 CAATTGTATCAGAATCTCCTGGG + Intergenic
1140580201 16:76222575-76222597 CACCTCTTTCAGACTTTCCAAGG + Intergenic
1141206019 16:81933776-81933798 AAATTCTATCAGACTTTTATTGG - Intronic
1144376231 17:14644768-14644790 CAGTTCTTTCAGCCTTTCCTGGG - Intergenic
1145751188 17:27356228-27356250 CAGTTCCTGCAGACCTTCCTGGG - Intergenic
1146018316 17:29251253-29251275 CAATTCTTTCAGTGTGGCCTAGG - Intronic
1146505598 17:33401949-33401971 CAATTCTTTCACAATCTTCTGGG - Intronic
1149690096 17:58568268-58568290 CAGTGCTGTCAGACCTTCCTTGG - Intronic
1151792658 17:76318659-76318681 TAATTTTTTCAGAATTTTCTTGG + Intronic
1151999857 17:77638460-77638482 CACTTCTTTCCGTCTCTCCTAGG - Intergenic
1152427997 17:80229027-80229049 CTATGCTTCCTGACTTTCCTGGG - Intronic
1155266238 18:24097045-24097067 CAATTTTGTGAGAATTTCCTTGG - Intronic
1155361859 18:25011066-25011088 TAATTCTTTCAGCTTTTGCTTGG + Intergenic
1155702064 18:28758235-28758257 CAATTCTTTCAGATTTAAATAGG - Intergenic
1156223010 18:35073025-35073047 CTATTCTTTTATAATTTCCTGGG + Intronic
1157379200 18:47195884-47195906 AAATTCTTTCAGCTTTTGCTTGG - Intergenic
1158247819 18:55451837-55451859 CAATTCTCTAAGTCTTTCCTTGG - Intronic
1160303500 18:77708340-77708362 AAACACTTTCAGACTTTTCTTGG + Intergenic
1160306370 18:77742779-77742801 CAAGTTTTTCAGATTTTCATTGG - Intergenic
1162618333 19:11819906-11819928 AAATTTTTTCACACTTTCCAGGG + Intronic
1164196106 19:22961283-22961305 TAATTCGTTCAGACTTTATTTGG + Intergenic
1164198032 19:22989792-22989814 AAATTTTTTTAGAATTTCCTGGG + Intronic
1166582194 19:43911190-43911212 CAATTCTTTCAGTATTGCCATGG - Intergenic
1167188611 19:47966484-47966506 CAATTCATTCAGAAAGTCCTAGG - Intergenic
1168563636 19:57404434-57404456 GAAGTCCTTCAGACTTTCCCAGG - Intronic
925540597 2:4962491-4962513 CTATGCTTTCATAGTTTCCTTGG + Intergenic
927500258 2:23577857-23577879 CTCTCCTTTCAGATTTTCCTTGG - Intronic
928767388 2:34663460-34663482 CAATTGCTTCAGACCTTTCTGGG - Intergenic
928807567 2:35178931-35178953 CAAATCTTTCTGACCTCCCTTGG + Intergenic
928821682 2:35369145-35369167 CAAGTCTTTGAGGCTTTCTTTGG + Intergenic
929489840 2:42386357-42386379 CCATCCTTGCTGACTTTCCTTGG - Intronic
931336393 2:61348159-61348181 CATTTCTTTCTGACATGCCTTGG + Exonic
931832036 2:66062733-66062755 AAATTCATTCAGTCTTTCCATGG + Intergenic
934772986 2:96919836-96919858 CATCTCTTTCTGTCTTTCCTGGG - Intronic
935165651 2:100566561-100566583 CAATTCTTTCAGACTTTCCTTGG - Exonic
936555527 2:113495245-113495267 GAATCCTTTCAGACTTACCAAGG - Exonic
936717926 2:115211392-115211414 CAATTTATTCAGGCCTTCCTAGG - Intronic
938771547 2:134505288-134505310 CAATTTTATCAGAATTTCCAGGG + Intronic
939549866 2:143601789-143601811 CAATTGTTCCTGACTTTCTTTGG + Intronic
940141399 2:150495231-150495253 CATGTATTTCAGACTTTTCTGGG - Intronic
942195524 2:173515078-173515100 CTATTCTTTCAGATTTTCTAAGG + Intergenic
942344790 2:174991263-174991285 CTCTTCTTTTAGACTTTTCTAGG - Intronic
943080083 2:183249027-183249049 CAATTCTTACCTCCTTTCCTTGG + Intergenic
943669296 2:190644244-190644266 CAATTCTTTCAGTCCTTCGAAGG - Intergenic
946427852 2:219608866-219608888 CATTTCTTTCAGTCTCTCCTTGG + Intronic
947889976 2:233608983-233609005 ACAGTTTTTCAGACTTTCCTTGG + Intergenic
947970914 2:234323758-234323780 CAATTCTGTTAGACCTTCCCAGG + Intergenic
948438455 2:237969427-237969449 CTCTTCATTCTGACTTTCCTAGG + Intronic
1169189934 20:3652089-3652111 CACTTCTTCCAACCTTTCCTTGG - Intergenic
1170004373 20:11648968-11648990 TAATTCTTTAGGACTGTCCTTGG + Intergenic
1170166288 20:13363103-13363125 CAAATCTCTCAGAATTTCCTGGG + Intergenic
1170564644 20:17591126-17591148 CCATTCTTTCAGTATTTCCGTGG - Intronic
1172927187 20:38548720-38548742 CAAGTCTTCCAGACATTCCCCGG - Exonic
1173377196 20:42496818-42496840 TAATCCTTTCAGACTTTCATGGG + Intronic
1173445897 20:43117845-43117867 CAATCTTTTTAGACTTCCCTGGG - Intronic
1174802794 20:53579006-53579028 AAATTTTGACAGACTTTCCTAGG - Intronic
1174857114 20:54056723-54056745 CAAAGCTTTTAGAATTTCCTAGG - Intronic
1175452968 20:59085647-59085669 CCTTTCTTTCAGATTTTCTTTGG + Intergenic
1175476398 20:59277915-59277937 CAATTTTCTCAGACTTGTCTTGG + Intergenic
1177110065 21:17016137-17016159 CTATTTTTTCAGATATTCCTTGG - Intergenic
1177788934 21:25700956-25700978 GTATCCTTTCAGACTTGCCTTGG - Intronic
1178280593 21:31279220-31279242 AACTTCTTTCTGACTTTCGTGGG + Intronic
1180692030 22:17724960-17724982 CTATTCTTACAGAATTTACTAGG - Intronic
1181098806 22:20524919-20524941 CAATTTTTTGAGACGCTCCTGGG + Intronic
1184641672 22:45876304-45876326 AAAATCCTTCAGACCTTCCTGGG + Intergenic
949706687 3:6826687-6826709 CAATTATTTCTGACTGTTCTTGG + Intronic
950216172 3:11161288-11161310 CATTTCTTTCAAACTTTTCCAGG + Intronic
950366162 3:12485595-12485617 CAATTACATCAGAATTTCCTGGG - Intronic
951030679 3:17878084-17878106 CAATTCTTTCAGACTTTCCTTGG + Intronic
951841057 3:27034778-27034800 CAAATCTCTCAGACTTTGCTTGG - Intergenic
955851989 3:63230558-63230580 CATTTCTTTCTGAGTTGCCTTGG + Intronic
956191873 3:66615711-66615733 CAATTCTTTAACCCTATCCTGGG - Intergenic
956226751 3:66968752-66968774 CAATTTAATCTGACTTTCCTTGG + Intergenic
956624051 3:71249301-71249323 CAATTCAGTCAGCCTTTCTTGGG + Intronic
956740527 3:72272214-72272236 CAATTCATTCTGATTTACCTAGG - Intergenic
957121109 3:76094192-76094214 AAATTCTTTCAGACTTTCTGAGG - Intronic
958010104 3:87866166-87866188 CAATTATTTGACACTTTCTTAGG - Intergenic
959072145 3:101712537-101712559 CAATTCTTTCAGACTTTCCTTGG - Intergenic
959850477 3:111081065-111081087 CAATTCTTTGAGACCAGCCTGGG + Intronic
960439662 3:117671264-117671286 CAATTCATCCAGGCTTTCCCAGG + Intergenic
961287885 3:125821190-125821212 CAATTATTACAGAATCTCCTGGG - Intergenic
963900004 3:150724968-150724990 CAGTTCTTTAATACTTGCCTGGG + Intergenic
964959304 3:162404188-162404210 TAATTTTTTGAGACTCTCCTTGG - Intergenic
967429115 3:189361225-189361247 CATTTCTGTCAAAATTTCCTTGG + Intergenic
970660866 4:18284283-18284305 GAAGACTTTCAGAATTTCCTAGG - Intergenic
970694045 4:18654944-18654966 GAATTGTTTCTCACTTTCCTAGG + Intergenic
971302003 4:25449734-25449756 AAAATGTATCAGACTTTCCTTGG + Intergenic
972350595 4:38232764-38232786 TAAGTCTTCCAGACTTGCCTTGG + Intergenic
973192161 4:47397881-47397903 CTATTTTTTCAGAGTTTTCTTGG + Intronic
974848021 4:67374932-67374954 CAAGTTTTTCAGACTGACCTTGG - Intergenic
975597090 4:76058330-76058352 CAATTCATTCAGACTGTCAAAGG - Intronic
976117950 4:81748192-81748214 CAATTGTAGCACACTTTCCTGGG - Intronic
977407625 4:96620268-96620290 CAATTCTTTGAGTCCTTTCTAGG + Intergenic
978052851 4:104223939-104223961 AAATGCTTCAAGACTTTCCTAGG + Intergenic
978339012 4:107701868-107701890 CATCTCTTTCACACTTTCTTTGG - Intronic
978693704 4:111549043-111549065 AAATTCTTTCAGACTTCATTGGG + Intergenic
978747882 4:112214692-112214714 CAATTCTTTCACTTTTTCTTTGG - Intergenic
979878256 4:125920970-125920992 AAGTTCTTTCAGACTTCCCTAGG + Intergenic
980102567 4:128556093-128556115 CATTTCTTTAAGATTTTCTTTGG + Intergenic
980609448 4:135138554-135138576 GTATTCTTTCAGAGTTTCCAAGG - Intergenic
981414418 4:144473985-144474007 CATTTTTTTCTGAATTTCCTAGG - Intergenic
982392752 4:154883859-154883881 TAATTTTTTCTGACTTTCCATGG + Intergenic
983507171 4:168566238-168566260 CAATTCTTTCAGTTTTTCACAGG + Intronic
983696614 4:170540665-170540687 ACTTTCTTTCAGACTTTCGTTGG + Intergenic
983893164 4:173052465-173052487 CAATCCCTTTAGACTTTCTTAGG + Intergenic
987154233 5:15071795-15071817 CAACTCTTTCCCTCTTTCCTGGG + Intergenic
987707747 5:21476941-21476963 CAAATCTTTTAGAATTTTCTTGG + Intergenic
987800370 5:22688005-22688027 CTATTCTCATAGACTTTCCTTGG - Intronic
988220441 5:28339240-28339262 CAAATATTTCAGATTTTCCATGG - Intergenic
988407571 5:30843172-30843194 CTATTCTTTGGGACTTTGCTAGG - Intergenic
990224844 5:53638276-53638298 AAATCCTTTGAGACTTTCCAGGG + Intronic
991156945 5:63448947-63448969 CAATTCCTTCGGACTTGTCTTGG - Intergenic
993222361 5:85116624-85116646 CATTTTTTTCATACTTTGCTGGG - Intergenic
993482644 5:88443791-88443813 CAATTATTCCAGACTAGCCTAGG + Intergenic
996992057 5:129647097-129647119 CAATTATTTTATACTTTACTTGG - Intronic
997038011 5:130216215-130216237 CAATTCTTGAAGAATTTCATGGG - Intergenic
997752723 5:136363756-136363778 CAGTTTTTTCAAACTGTCCTAGG + Intronic
998896533 5:146806014-146806036 CAACTCTTTCAGAATTTTCTGGG + Intronic
1000974686 5:167752023-167752045 CAATTCATTCTGAATTTCTTAGG - Intronic
1001985121 5:176067970-176067992 AAAGTCTTTCATACTTACCTTGG + Intronic
1002231744 5:177770165-177770187 AAAGTCTTTCATACTTACCTTGG - Intronic
1002263597 5:178013588-178013610 AAAGTCTTTCATACTTACCTTGG + Intronic
1003115094 6:3278306-3278328 CAACTCTTTCAGCCTCTCCCTGG - Intronic
1004156892 6:13177519-13177541 GAATTCTTTCAGGCTCTCATGGG - Intronic
1005123028 6:22412108-22412130 GAATACTCTCAGCCTTTCCTGGG - Intergenic
1007150641 6:39687503-39687525 TCATTCTTTCATTCTTTCCTGGG + Intronic
1007949298 6:45856764-45856786 CAACTCTCTCTGACTTTTCTTGG + Intergenic
1008331065 6:50245509-50245531 CAAATCTATCAGAGTTTCATGGG + Intergenic
1009256431 6:61409420-61409442 GAACTCTTTCAGACCTTCATTGG + Intergenic
1010472652 6:76247763-76247785 TAATTCTTTCAGGCTTTTCAGGG - Intergenic
1010568463 6:77448203-77448225 CAACTCTTCTTGACTTTCCTAGG - Intergenic
1012526420 6:100183303-100183325 CAATACTTACTAACTTTCCTGGG + Intergenic
1013021513 6:106225298-106225320 CAATTCATTCAGATTTTTCAAGG + Intronic
1013109822 6:107056031-107056053 CAATATTTTCAGACTTTCCTGGG + Intergenic
1014044303 6:116866721-116866743 AAATGCTTTCAGAATTGCCTGGG - Intergenic
1014441888 6:121483190-121483212 CAATACTTTCAGCCTTTCAAGGG - Intergenic
1014703044 6:124713333-124713355 CCATTCTTACAGGCTTTCTTAGG - Intronic
1016055390 6:139573165-139573187 CAGTCCTTTAAGACTGTCCTAGG + Intergenic
1018096200 6:160389361-160389383 CAATTCTGTCAGCCAGTCCTTGG + Intronic
1019899737 7:4010954-4010976 TCATTCTTTCAGACTCTCCATGG + Exonic
1021001727 7:15340200-15340222 CAATTTATTCAGCCTTTCCAAGG - Intronic
1022249650 7:28594454-28594476 CTAGTCTTTCAAACATTCCTGGG + Intronic
1023167589 7:37358042-37358064 CAATTCATTCAGAATGCCCTGGG - Intronic
1023234487 7:38069633-38069655 CAATTTTTTTATACTTTTCTAGG - Intergenic
1024300922 7:47886989-47887011 CAATTCTTTGAGACATATCTAGG + Intronic
1024409265 7:49020499-49020521 AAATTCTTTACGGCTTTCCTTGG + Intergenic
1024945359 7:54802482-54802504 CCATTCTCTCAGACATTTCTTGG + Intergenic
1026420265 7:70229266-70229288 GAATTCTTTCAGTCTTTAATAGG + Intronic
1027508320 7:79046543-79046565 GAATATTTTCAGACTTTCTTAGG - Intronic
1027966613 7:85018082-85018104 CCATTGTTTCAGCCTTGCCTTGG - Intronic
1028082162 7:86590982-86591004 AAATTATTTCACATTTTCCTTGG - Intergenic
1028535093 7:91882887-91882909 TAATTATTTCAGACTTACTTAGG + Intergenic
1029549093 7:101227437-101227459 AAATTGTTTCAGGCTGTCCTTGG - Intergenic
1030110059 7:106019349-106019371 CAATTATCTCCAACTTTCCTTGG - Intronic
1030502183 7:110373456-110373478 AAATTCTTTCACAATTTCCATGG + Intergenic
1031397933 7:121294716-121294738 GAAATCTTACAGACCTTCCTGGG + Intronic
1032483647 7:132266463-132266485 CAATTCATTAAGAGTTTCGTAGG - Intronic
1034061898 7:148099764-148099786 GAATTCTTTCAGCCATTCCCAGG + Intronic
1035392356 7:158513315-158513337 ACATTTTCTCAGACTTTCCTTGG - Intronic
1035868254 8:3108748-3108770 CACCTCTTTCTGTCTTTCCTAGG - Exonic
1036400476 8:8403432-8403454 CTATTGTTTAAGACTTTTCTAGG + Intergenic
1037188729 8:16096570-16096592 CATTTCTTTCTGATTTTACTTGG + Intergenic
1037385719 8:18338373-18338395 CCAATCTTTCAGTTTTTCCTGGG + Intergenic
1037511568 8:19588436-19588458 GAATTCTTTCTGAGTTTGCTTGG - Intronic
1037651823 8:20845954-20845976 CAACTGTTTCACATTTTCCTGGG - Intergenic
1038029300 8:23623068-23623090 CACTTCTTTCTGTCTTTACTGGG + Intergenic
1038111777 8:24507820-24507842 CTATTCTTTCAGACTTTTGTTGG + Intronic
1040316828 8:46266412-46266434 TGATTCTTTGGGACTTTCCTTGG + Intergenic
1040683327 8:49840218-49840240 CATTCCCTTCAGAGTTTCCTTGG + Intergenic
1040971966 8:53144935-53144957 GAATTCATTCAGTGTTTCCTAGG - Intergenic
1041659473 8:60387284-60387306 CAATTCTTTCAGACTTTCCTTGG + Intergenic
1041659483 8:60387343-60387365 CAATTCTTTCAGACTTTCCTTGG - Intergenic
1042287712 8:67132479-67132501 CAATCCTTTCATACTTTTCTTGG - Intronic
1043196118 8:77293861-77293883 CAATGATTTCATATTTTCCTGGG - Intergenic
1043518920 8:81023870-81023892 AAATTCTTACAGACTTTTCATGG - Intronic
1043836783 8:85056893-85056915 CCATTCTTTAAGACAGTCCTGGG - Intergenic
1045032259 8:98148313-98148335 ACATCCTTTCAGACTTTTCTTGG - Intronic
1045406559 8:101872463-101872485 TGATTCTTTTATACTTTCCTTGG + Intronic
1046361835 8:113169660-113169682 CAATTCTATTAGTTTTTCCTGGG + Intronic
1046530590 8:115440204-115440226 TAAGTTTTTCAGACTTTTCTTGG - Intronic
1047636105 8:126764309-126764331 CAAATCTGGCACACTTTCCTAGG - Intergenic
1048092599 8:131257528-131257550 CATTTTTTTCACACTTTCCTTGG - Intergenic
1048917702 8:139200538-139200560 CAATTCCTCCAGCCTTGCCTAGG + Intergenic
1051667287 9:19477117-19477139 CAATTCAGTCAGAATCTCCTAGG - Intergenic
1052077634 9:24162636-24162658 CTATTCTTTCAGGATTACCTTGG + Intergenic
1052311440 9:27073356-27073378 CAATTATGTCAGATTTTCCTGGG + Intergenic
1053364458 9:37512651-37512673 AAATTCTCTCAGACGTCCCTCGG - Exonic
1055706820 9:79014655-79014677 CAATCCTTGCTGCCTTTCCTTGG + Intergenic
1056057915 9:82847891-82847913 CCATCCTGTCAGATTTTCCTAGG - Intergenic
1056739074 9:89237151-89237173 CTAGTCTTTCTGACTTACCTGGG + Intergenic
1056999618 9:91495600-91495622 AAATTCTTTTAGACTAACCTCGG + Intergenic
1058414109 9:104767270-104767292 GAATTCTTTCATACTACCCTAGG + Intronic
1058855299 9:109056160-109056182 CAATTCTTTTAGCTTTCCCTGGG - Intronic
1059624781 9:116051282-116051304 CCAGTTTTCCAGACTTTCCTTGG - Intergenic
1061788645 9:133046479-133046501 CAAATCTTCCAGACTTTTCTAGG - Intronic
1185917998 X:4057434-4057456 AAAATCTTTCTGATTTTCCTTGG + Intergenic
1186600003 X:11026761-11026783 TTATTATTTCAGACTTTCCATGG + Intergenic
1186682382 X:11889397-11889419 CAATTCATTCAGACTTACAATGG - Intergenic
1186704352 X:12126284-12126306 CTATTCATTCTGACCTTCCTTGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187797570 X:23021069-23021091 CAATTCTTTCCCACTCTCCAAGG + Intergenic
1188226363 X:27602577-27602599 CAATTTGTTGAGACTTTCTTAGG - Intronic
1189400499 X:40663646-40663668 TGATTCTTTCAGACTCTGCTGGG - Intronic
1189503730 X:41589995-41590017 AAATTCTTCCAGACGTGCCTTGG - Intronic
1192016854 X:67340561-67340583 AAACACTTTCAGGCTTTCCTTGG - Intergenic
1193848840 X:86509996-86510018 CAATTTTCACAGACTGTCCTGGG + Intronic
1194020091 X:88678271-88678293 CTATTCTTTCAAACTTTTATAGG - Intergenic
1195112355 X:101660159-101660181 GAATTGTTTCATCCTTTCCTGGG + Intergenic
1197032703 X:121836879-121836901 AAATATTTTCAGTCTTTCCTTGG - Intergenic
1200956371 Y:8950967-8950989 CAACTCTTTTAGAATTTCTTCGG - Intergenic
1201336383 Y:12885003-12885025 TTATTCTTTCAGTGTTTCCTAGG + Intergenic