ID: 951034751

View in Genome Browser
Species Human (GRCh38)
Location 3:17920842-17920864
Sequence TAAATTTGATGGTTTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951034748_951034751 1 Left 951034748 3:17920818-17920840 CCTCGGTTTTGCTTGATCAACAG 0: 1
1: 0
2: 1
3: 3
4: 52
Right 951034751 3:17920842-17920864 TAAATTTGATGGTTTCTTGAGGG 0: 1
1: 0
2: 1
3: 33
4: 447
951034747_951034751 2 Left 951034747 3:17920817-17920839 CCCTCGGTTTTGCTTGATCAACA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 951034751 3:17920842-17920864 TAAATTTGATGGTTTCTTGAGGG 0: 1
1: 0
2: 1
3: 33
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951034751 Original CRISPR TAAATTTGATGGTTTCTTGA GGG Intronic
900844213 1:5083225-5083247 GAAATCTGATGGTTTTCTGAAGG - Intergenic
903895188 1:26598271-26598293 TATATTTAATTGTTTTTTGAGGG - Intergenic
904932766 1:34103164-34103186 AATACTTGATGGTGTCTTGAGGG - Intronic
905855468 1:41308709-41308731 AAAATTTGATGGTTTTATAAGGG - Intergenic
907995236 1:59624707-59624729 GAGATTTGATGGTTTCATAAGGG - Intronic
908677335 1:66620058-66620080 AAAATTTGATGTTTACTTAATGG + Intronic
908901707 1:68963610-68963632 GAAATTTGATGGTTTTATAAGGG + Intergenic
909580077 1:77223499-77223521 GAAATCTGATGGTTTCATAAAGG - Intergenic
909865792 1:80668886-80668908 TAAATCATATGGTTTCATGAAGG - Intergenic
910336547 1:86138522-86138544 TAGATCTGATGGTTTTTTAAGGG + Intronic
910567458 1:88661047-88661069 TAAATGTGATTATTTATTGAAGG - Intergenic
910628402 1:89332968-89332990 TAAATTTAATTGTCTCTTAAAGG + Intergenic
911366149 1:96940065-96940087 TAATTTTTATGTTTTCTTCAGGG + Intergenic
912276719 1:108266115-108266137 TAGATTTGTTGATTTTTTGAAGG - Intergenic
912291511 1:108428242-108428264 TAGATTTGTTGATTTTTTGAAGG + Intronic
912426713 1:109599670-109599692 TAAGTTTGCTTGTTTGTTGAAGG - Exonic
912893537 1:113560803-113560825 TAGATTTGTTGATTTTTTGAAGG - Intronic
913480505 1:119284382-119284404 GAAAATTGATGGTATCTTAAGGG - Intergenic
914782616 1:150799479-150799501 CAAACTTGATGGTTTCTCGAAGG - Intronic
917528150 1:175808142-175808164 TAAACTTGAGAGTTTCCTGAAGG - Intergenic
917611674 1:176694998-176695020 TACATTTGAATGGTTCTTGATGG + Intronic
918577952 1:186086615-186086637 TAAATTTTATCATTTCTTGAAGG - Intronic
918614507 1:186529108-186529130 TGGATTTGTTGATTTCTTGAAGG + Intergenic
918670590 1:187210623-187210645 GAGATCTGATGGTTTCATGAAGG + Intergenic
918892449 1:190293555-190293577 TAACTTTGATGTTTCCTTGTTGG + Intronic
921347222 1:214198825-214198847 TAAACCTGATGCTTTCTTCAGGG - Intergenic
921586260 1:216949318-216949340 TAATGTTGAAGGTTTCTTAAGGG + Intronic
922879003 1:228965001-228965023 TAAATTTGATGCCTTTCTGAAGG - Intergenic
923635142 1:235688090-235688112 TAAATTTTATTCTTTCTTGGAGG + Intronic
924204637 1:241699011-241699033 GAGATTTGATGGTTTCATAAAGG - Intronic
924610655 1:245570932-245570954 TAGATTTGATGATATCTGGAAGG - Intronic
1063073941 10:2695575-2695597 AAGATCTGATGGTTTTTTGAAGG - Intergenic
1063195927 10:3743200-3743222 TAAATTTTATGGTTTCTTTTAGG - Intergenic
1063216214 10:3927909-3927931 TAAAATTGATGGTGTTTTGGGGG - Intergenic
1063522186 10:6751112-6751134 GAAATCTGATGGTTTTATGAGGG - Intergenic
1063690000 10:8278017-8278039 TGAAAATGATGGATTCTTGAAGG + Intergenic
1064985411 10:21204865-21204887 TAAATGTCATGGTTTCATGACGG - Intergenic
1065241084 10:23705548-23705570 TAAATGTGAGGGTTTATTTATGG + Intronic
1065573287 10:27094063-27094085 AATATCTGATGGTTTCTTAAGGG + Intronic
1065626912 10:27639138-27639160 GAAATTTGATGGTTTTATAAGGG - Intergenic
1066685627 10:37978663-37978685 TAAATTTTATAGTTTCTCTAAGG - Intergenic
1067243944 10:44520322-44520344 TAATTTTAAAGGTTTGTTGATGG - Intergenic
1067421265 10:46151442-46151464 TAAAGATGATGGTTGCATGAGGG - Intergenic
1067506603 10:46857901-46857923 TAAAGATGATGGTTGCATGAGGG - Intergenic
1068425940 10:56864261-56864283 TGAATTTGATTTTTTCTTTAAGG + Intergenic
1069027459 10:63558424-63558446 TAAATTTCATGGGTTTTAGATGG + Intronic
1069759192 10:70796604-70796626 TAGATTTGTTGATTTTTTGAAGG + Intergenic
1070526669 10:77301481-77301503 TAAACTTGATGGACTTTTGAAGG + Intronic
1074177344 10:111022338-111022360 TAAATTTTATGATTTATTAAAGG + Intergenic
1074485470 10:113873185-113873207 TAACCTTGATTGATTCTTGAAGG - Intronic
1074504611 10:114057701-114057723 TAAAAATGATGGTTTTGTGATGG + Intergenic
1076564320 10:131387659-131387681 TAAAGTTCATGGTTTACTGACGG + Intergenic
1078294311 11:10051112-10051134 TAAATTGAATGATCTCTTGAAGG + Intronic
1079463871 11:20709576-20709598 GAATTTTGATGGTATTTTGATGG + Intronic
1079570921 11:21942435-21942457 TAAATCTGATGGTTTTATAAGGG + Intergenic
1080043075 11:27779634-27779656 TAAAGTCGGTGGTTTCTTTAAGG + Intergenic
1080189995 11:29533664-29533686 TAATTTTGATGTTTCCTTGCAGG + Intergenic
1080545398 11:33312246-33312268 TATATTTGAAGGTGCCTTGATGG + Intronic
1081508478 11:43743091-43743113 TAAATTTGATAGTTGCTAGCAGG + Intronic
1083152690 11:60802779-60802801 GAATGTTGATGGTTTCTTCAAGG + Intergenic
1086083250 11:82927475-82927497 TAAATTTGATTGTTGCCAGATGG - Intronic
1086605137 11:88686696-88686718 AAAATCTGATGGTTTTATGAGGG + Intronic
1087223995 11:95577621-95577643 TAAATCTGATGGTCTTCTGAAGG - Intergenic
1087415420 11:97849350-97849372 TTACTTTGATAGTTGCTTGAAGG + Intergenic
1087438687 11:98155658-98155680 AAAATTTGAGGGTTTATTTATGG + Intergenic
1087569417 11:99905676-99905698 GAAAGTTAATGGTATCTTGATGG + Intronic
1087960910 11:104347883-104347905 TAGATCTGATGGTTTTTTAAGGG + Intergenic
1088562948 11:111134402-111134424 GAGATTTGATGGTTTTTTAAAGG - Intergenic
1088621825 11:111692647-111692669 TAAATTTTATAACTTCTTGATGG + Intronic
1090567394 11:128009647-128009669 TAGATTTGTTGATTTTTTGAAGG - Intergenic
1092223390 12:6730677-6730699 TAACTTTAATGGTTTTTTTAAGG - Exonic
1092952557 12:13520825-13520847 CAAATTTGTTGATTTTTTGAAGG + Intergenic
1093850836 12:24035924-24035946 TAAATTTGATCATTTCTGAAAGG - Intergenic
1094694703 12:32806661-32806683 TGAATTTGTTGATTTTTTGAAGG + Intronic
1095410385 12:41914861-41914883 AAAATCTGATGGTTTCATAAGGG + Intergenic
1095527188 12:43141047-43141069 GAGATTTGATGGTTTTTTAAAGG + Intergenic
1095531219 12:43189230-43189252 TAAATCTGATGGTTTCATAAGGG + Intergenic
1096410441 12:51373382-51373404 GAAATCTGATGGTTTTATGAGGG + Intronic
1096943263 12:55373126-55373148 TAAATTTGATATTTTTATGAGGG - Intergenic
1097544823 12:60985894-60985916 GAAATCTGATGGTTTCATAAGGG - Intergenic
1098330901 12:69352443-69352465 TAAAGTAGATTGTTTCTTCAAGG - Intronic
1099339660 12:81412186-81412208 AAAATTTTAGGATTTCTTGAGGG + Intronic
1099411284 12:82331373-82331395 TTTATTTCATGTTTTCTTGAAGG + Intronic
1099733238 12:86533206-86533228 TAGATTTGATGGTTTCTGAACGG - Intronic
1099767600 12:87008272-87008294 CAAATTTGATGGCTTCTTGTTGG - Intergenic
1099999976 12:89821577-89821599 TAAATTTAATGATTGCTTTAGGG - Intergenic
1106600843 13:31185264-31185286 GAAATTTAATGTTGTCTTGAGGG + Intergenic
1106694877 13:32162632-32162654 TGAATGTGAAGGTTTCCTGAAGG + Intronic
1107053243 13:36075162-36075184 AAAATTAGATGGGTTATTGAAGG + Intronic
1107243961 13:38270173-38270195 TATATTTGTTGATTTTTTGAAGG - Intergenic
1107420001 13:40237324-40237346 CAAATTTCATGATTTCATGAAGG - Intergenic
1108154457 13:47571518-47571540 GAGATTTGATGGTTTCATAAGGG + Intergenic
1109168674 13:59068145-59068167 TTACTTGGATGTTTTCTTGATGG + Intergenic
1109254265 13:60059742-60059764 TCTATTTGATGGTTCATTGAAGG + Intronic
1109335283 13:60986267-60986289 TAAATTTATTGTTTACTTGAGGG + Intergenic
1111276735 13:85958308-85958330 GAGATCTGATGGTTTCATGAGGG + Intergenic
1111350336 13:87020323-87020345 GAACTTTGATGGTTTATTGATGG + Intergenic
1111697946 13:91649052-91649074 GAGATTTGATGGTTTCATAAGGG + Intronic
1111756065 13:92397319-92397341 GAGATTTGATGGTTTCATAAGGG + Intronic
1112081505 13:95976658-95976680 GAAAGTTGATGGTAGCTTGATGG - Intronic
1112153503 13:96791496-96791518 CAAGTTTGATGGTTTTTTGTGGG - Intronic
1112265126 13:97916609-97916631 GAAATGTGATGGTTTTGTGAGGG - Intergenic
1112658744 13:101482577-101482599 TAAATTTCATGGTATATTTAGGG - Intronic
1113061035 13:106322958-106322980 TAAATTTGGTGGTTTCTCTGTGG + Intergenic
1113243884 13:108372621-108372643 TAAATTTGATAGTATTTTGTTGG + Intergenic
1114177904 14:20340227-20340249 TAAATTTGTTGGTTTCTTCCAGG + Intergenic
1115120927 14:29936632-29936654 TAAATTGTTTTGTTTCTTGAGGG - Intronic
1115430915 14:33317604-33317626 GAGATCTGATGGTTTCTTGAGGG + Intronic
1116520999 14:45847060-45847082 TCACTTTGAAGGTTTCTTAAGGG - Intergenic
1117312786 14:54544870-54544892 TAAATTTGAAGGTTTATTTCTGG + Intergenic
1118021257 14:61717496-61717518 TATATTAGTTGTTTTCTTGAAGG + Intronic
1118151297 14:63193886-63193908 AAAATTTGATGGTTTTATAAGGG + Intergenic
1118528344 14:66671689-66671711 GAACTTTGATGGTGTCTTTAAGG + Intronic
1119962974 14:78881022-78881044 AAGATTTGATGGTTTCATAAGGG + Intronic
1121581176 14:95032467-95032489 TAAATTTGAGGGTTTATTTCTGG + Intergenic
1121746339 14:96297251-96297273 AAAATTTGCTGTTTTTTTGAAGG - Intronic
1121980944 14:98453092-98453114 GAAATTTGATGGTTTTATAAGGG - Intergenic
1122004690 14:98692455-98692477 TAAAATTGATGGCTTCAGGATGG + Intergenic
1124009099 15:25821499-25821521 TAAATTTGATCTTTCCTTTAAGG - Intronic
1124069028 15:26374121-26374143 AAGATCTGATGGTTTCTTAAAGG - Intergenic
1126844467 15:52746047-52746069 AAAATCTGATGGTTTCATAAGGG + Intergenic
1127191036 15:56530763-56530785 TATATTTTATGCTTTCTTAAAGG + Intergenic
1127230594 15:56989666-56989688 TCAGTTTGCTGGTTTCTAGAGGG + Intronic
1127545641 15:59992792-59992814 TACGTTTGGTGGTTTGTTGAGGG + Intergenic
1128485027 15:68076596-68076618 TAAATTTTATTGTTACTTGGAGG + Intronic
1130440831 15:83952475-83952497 TAAATTGGATGGTTCTTTGTTGG + Intronic
1131756297 15:95566341-95566363 AATATTTGATGGTTTCTGGATGG + Intergenic
1131870935 15:96764287-96764309 TAAATTGGATGGATTATTTAAGG - Intergenic
1131887975 15:96939741-96939763 TAAATTTGCTAGTATTTTGAGGG + Intergenic
1131958264 15:97761419-97761441 TAAATATGCAGGTTTCCTGAGGG + Intergenic
1132178684 15:99734869-99734891 TAGATTTGATGGTTTTATAAAGG + Intergenic
1134359683 16:13519774-13519796 AAAATCTGATGGTTTCATAAGGG - Intergenic
1135314589 16:21433776-21433798 TAAATCTGATGGTTTTATAAAGG + Intronic
1135367512 16:21866056-21866078 TAAATCTGATGGTTTTATAAAGG + Intronic
1135444302 16:22505106-22505128 TAAATCTGATGGTTTTATAAAGG - Intronic
1136193197 16:28631140-28631162 TAAATCTGATGGTTTTATAAAGG - Intergenic
1136222765 16:28838913-28838935 TCATTTTGATGCTTTCTGGAAGG + Intergenic
1136311255 16:29412457-29412479 TAAATCTGATGGTTTTATAAAGG + Intergenic
1136324702 16:29514254-29514276 TAAATCTGATGGTTTTATAAAGG + Intergenic
1136439387 16:30254239-30254261 TAAATCTGATGGTTTTATAAAGG + Intronic
1137598772 16:49742389-49742411 TAAATTTGATTTTTTCTTGCAGG - Intronic
1138013261 16:53404479-53404501 TACATTTGATGGTTTCTAAAAGG - Intergenic
1138041121 16:53668224-53668246 GAGATTTTATGGTTTCTAGAAGG + Intronic
1138429332 16:56958486-56958508 CAAATGTGATGTATTCTTGATGG + Intergenic
1138841122 16:60508017-60508039 TAAATTTGATAAATTGTTGAAGG + Intergenic
1139033381 16:62912487-62912509 TAAATTTGATGGTTTTATAAGGG - Intergenic
1139885893 16:70206537-70206559 TAAATCTGATGGTTTTATAAAGG + Intergenic
1140314967 16:73887635-73887657 TAAATTTTTTGGTTTCTTCCTGG - Intergenic
1140522670 16:75595554-75595576 TAAATTTGTTGGTTTTTTTGGGG + Intergenic
1140964624 16:79953056-79953078 TAAATCTAATGATTTCCTGAGGG - Intergenic
1140988780 16:80187773-80187795 CAAATATTCTGGTTTCTTGATGG - Intergenic
1141235753 16:82214487-82214509 GAGATCTGATGGTTTTTTGAGGG + Intergenic
1144277247 17:13684130-13684152 TAAATGTGAATTTTTCTTGAAGG - Intergenic
1144562104 17:16329366-16329388 AGAATTTCATGGTTCCTTGAAGG + Intronic
1145354207 17:22123640-22123662 TAACTTCGTTGGATTCTTGAAGG - Intergenic
1145358337 17:22184569-22184591 TGAATTTGTTTGTTTCTTGGGGG - Intergenic
1149084826 17:52703384-52703406 TAAAATTGATGGTTGCTAAAGGG + Intergenic
1150542415 17:66116384-66116406 AAATTTTGATTGTTTCTTGTAGG + Intronic
1151084298 17:71363370-71363392 GAAATCTGATGGTTTTTTAAGGG - Intergenic
1151084825 17:71368028-71368050 GAGATTTGATGGTTTTATGAAGG - Intergenic
1153714877 18:7838242-7838264 AAAATCTGATGGTTTCATAAAGG - Intronic
1154002045 18:10490177-10490199 TAAATTCTATTGTTTCTTGTTGG - Intergenic
1155132264 18:22949681-22949703 AAACTTTAATGGTTTCATGAAGG - Exonic
1156606791 18:38675701-38675723 TATATTTGATGTTTTCTTATAGG - Intergenic
1156730372 18:40187043-40187065 TAACTTTGATGATTTGTTTAAGG + Intergenic
1157067707 18:44371434-44371456 TGAATTTGTTGATTTCTTGAAGG + Intergenic
1157096022 18:44686043-44686065 TAAGTATTGTGGTTTCTTGATGG - Intronic
1157801030 18:50621529-50621551 TAAAATGGATGGCTTCTTGGCGG - Intronic
1157964180 18:52189576-52189598 TAAAATTGAAGGTGTCTTGAGGG - Intergenic
1158375554 18:56859308-56859330 TAATTTTTATTGTTTCTTTAGGG + Intronic
1158754630 18:60307162-60307184 TAAATTTGTTGGTTTTTTATTGG - Intergenic
1158805588 18:60968160-60968182 TAAATTTTGTGTTTTCTAGATGG - Intergenic
1159266145 18:66082218-66082240 AAAATTTGCTGTATTCTTGATGG - Intergenic
1159498578 18:69238497-69238519 GAGATTTGATGGTTTTATGAAGG - Intergenic
1162156632 19:8682959-8682981 TAGATTTCATTGTTTCTGGAAGG - Intergenic
1162550191 19:11354527-11354549 TATATTTGGGGGTTACTTGAGGG + Intronic
1167770972 19:51517967-51517989 TAAAAATGATGGTTTGTAGAGGG - Intergenic
1168366964 19:55796597-55796619 TAAATGTGATGGTAAGTTGAGGG - Intronic
926834592 2:17004280-17004302 GAAATGTGATTGTTTCTGGAGGG - Intergenic
927330173 2:21853416-21853438 TGATTTTGATGGTATATTGATGG + Intergenic
927352251 2:22130033-22130055 TAAATGGTATTGTTTCTTGATGG - Intergenic
927447261 2:23174701-23174723 TAGATTTGTTGATTTTTTGAAGG - Intergenic
928050075 2:27983280-27983302 TAAATTTGAAGGTTTATTTATGG + Intronic
928079323 2:28295357-28295379 TAAAATTGTTGCTTTCTTGTAGG + Intronic
928192066 2:29180203-29180225 TAGTTTTGATGGTTTCTTTCTGG + Intronic
928460550 2:31468293-31468315 GAAATTTGATGGTTTTATAAAGG + Intergenic
929578015 2:43064684-43064706 TAAAATGGAAGGGTTCTTGAGGG - Intergenic
930881565 2:56276521-56276543 GAGATCTGATGGTTTCATGAGGG + Intronic
931279199 2:60773481-60773503 TAAAAATGATAGTTTCTTAAAGG + Intronic
931482494 2:62655809-62655831 TAGAGTTGATGTTTGCTTGATGG + Intergenic
931749056 2:65314970-65314992 TAGATTTGCAGGTTTCTAGAGGG - Intronic
933116137 2:78474693-78474715 TAAATTTGTTGGTTTCTGGCTGG + Intergenic
934130712 2:88946147-88946169 TAATGTTTATGGTTTTTTGAAGG + Intergenic
934144324 2:89076413-89076435 GAATTTTAATGGCTTCTTGATGG + Intergenic
934224923 2:90124135-90124157 GAATTTTAATGGCTTCTTGATGG - Intergenic
934484413 2:94690294-94690316 AAAATTTGAAGTTTTCTTGAGGG - Intergenic
935053829 2:99548275-99548297 TAAATTTGAGAGTCTCTGGAAGG + Intronic
936764300 2:115827150-115827172 TTATTTTGATGGTTCCTTTATGG + Intronic
936791031 2:116152180-116152202 TAAATGTGTTGGTTTCTTTCTGG + Intergenic
937050200 2:118882345-118882367 TAAATTACATGGTTCCCTGAAGG - Intergenic
937473423 2:122192810-122192832 TCAATTTAATGGTTTCTGGTTGG + Intergenic
937590775 2:123610809-123610831 GAATTTTGTTGGCTTCTTGATGG + Intergenic
938090615 2:128430797-128430819 TTATTTTGCTAGTTTCTTGAGGG + Intergenic
938149150 2:128866530-128866552 TAAAGTTGATGGTTTAATGATGG + Intergenic
939288300 2:140161123-140161145 TGGATTTGTTGGTTTTTTGAAGG + Intergenic
939980776 2:148778109-148778131 TAAATCTGATTGTTTTGTGAAGG - Intronic
940525083 2:154802957-154802979 TAAATTAAATGGTATCTTCAAGG + Intronic
940705173 2:157096360-157096382 TATATTTTAATGTTTCTTGAAGG + Intergenic
941046651 2:160683582-160683604 TAAATTTTCTGGTCTGTTGATGG + Intergenic
941346042 2:164370917-164370939 GAAATCTGATGGTTTTTTAAAGG + Intergenic
941657646 2:168161102-168161124 TAGCTTTCATGGTTTCTTGGGGG - Intronic
942088444 2:172464355-172464377 GAGATTTGTGGGTTTCTTGATGG + Intronic
942885360 2:180916776-180916798 AAAATCTGATGGTTTTATGAGGG + Intergenic
942886977 2:180937656-180937678 TAGATCTGATGGTTTCATGAGGG + Intergenic
943989921 2:194675333-194675355 TAAATTAGGAGGTTTCTTAAAGG + Intergenic
944296843 2:198075089-198075111 TTAATTCGATGTTCTCTTGATGG - Intronic
944364009 2:198895108-198895130 TGAATTTGTTGATTTTTTGAGGG - Intergenic
946127620 2:217577906-217577928 TAAATTTGATGGCATCTATAGGG + Intronic
947062849 2:226186081-226186103 AAAATTTGATAGTTGCTGGAAGG + Intergenic
947064468 2:226206696-226206718 TAAATTTGTTCTTTTCTGGATGG - Intergenic
1170964526 20:21054266-21054288 TTTATTTGATGTTGTCTTGAGGG - Intergenic
1172379548 20:34476664-34476686 TAAATGTGATGGTTTTGTGGGGG + Intronic
1172726490 20:37047151-37047173 TATATTTCATCGTTCCTTGATGG - Exonic
1174889250 20:54372796-54372818 TAAATTTTATATTTTCATGATGG + Intergenic
1175477082 20:59284215-59284237 TATATTTGATGGTTTATTCTTGG + Intergenic
1176967129 21:15223934-15223956 TAGAATTGATGGGTTATTGATGG - Intergenic
1177117896 21:17107664-17107686 TGAATTTGTTGATTTTTTGAAGG - Intergenic
1177160483 21:17541847-17541869 TAAATTTGATCGTTTGATTAAGG + Intronic
1177259064 21:18705337-18705359 TAATATTGAAGGTTTATTGAGGG + Intergenic
1177391925 21:20486735-20486757 TACATTTAATGCTTTCTTCAGGG - Intergenic
1177560110 21:22739861-22739883 TAAATTTCATGTTTTCTTTTAGG - Intergenic
1177607474 21:23400282-23400304 GAAATCTGATGGTTTCATAAAGG - Intergenic
1178360316 21:31944033-31944055 TAAATTGGAGGGTTGTTTGACGG - Intronic
1178789084 21:35682112-35682134 TAATGCTGATGGTTACTTGAGGG + Intronic
1178809457 21:35867978-35868000 TAGATCTGATGGTTTTATGAGGG - Intronic
1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG + Intronic
1180604919 22:17050745-17050767 TAAATGTAATGGTTTCTTTCCGG - Intergenic
1182952229 22:34387894-34387916 GAAAGTTGATGGTAGCTTGATGG + Intergenic
1184962600 22:47942441-47942463 GAAATCTGATGGTTTTATGAGGG - Intergenic
949215633 3:1563892-1563914 TTAATTTGCTTTTTTCTTGAAGG - Intergenic
949216747 3:1579249-1579271 TAATTTTGATGATTTCTTCTTGG + Intergenic
949400820 3:3663797-3663819 GAAATCTGATGGTTTTTTAAAGG + Intergenic
949657342 3:6235793-6235815 AAGATTTGATGGTTTTATGAAGG + Intergenic
949818374 3:8087290-8087312 TATATTTTATTATTTCTTGAAGG - Intergenic
950166610 3:10805541-10805563 CCAAAATGATGGTTTCTTGAAGG - Intergenic
950299311 3:11861891-11861913 AAAATTTGAATGCTTCTTGAAGG + Intergenic
950393191 3:12712868-12712890 GAAATCTGATGGTTTTATGAGGG - Intergenic
951034751 3:17920842-17920864 TAAATTTGATGGTTTCTTGAGGG + Intronic
951085987 3:18513372-18513394 TTAATATGATAGTTTCTAGAAGG - Intergenic
951413932 3:22399666-22399688 TAAATGTGATGGTTTGTTTCTGG + Intergenic
952458511 3:33499154-33499176 AAAATCTGATGGTTTTGTGAGGG + Intronic
953066895 3:39481703-39481725 TGAATTTGAGGGTTTATGGAGGG - Intronic
955208996 3:56923669-56923691 TAAATCTCTTGGTTTCTTGGGGG - Intronic
955547363 3:60045572-60045594 TAAATTTTATGTTTTTTTAATGG + Intronic
955633404 3:60999855-60999877 CAAATCTGATGGTACCTTGATGG - Intronic
956363085 3:68470118-68470140 AAAATATGATGGTTTCATAAAGG + Intronic
957693318 3:83599714-83599736 TCAATCTGAAGGTTTCTGGAGGG - Intergenic
957913015 3:86647247-86647269 TACCTGTGTTGGTTTCTTGAGGG + Intergenic
958084327 3:88787025-88787047 GAAATTTGATGGTTTTATAAAGG - Intergenic
958179871 3:90046388-90046410 TAAATTGCATGGTAACTTGATGG + Intergenic
958563308 3:95776565-95776587 GAAATCTGATGGTTTCATAAAGG + Intergenic
959323213 3:104904763-104904785 TAAAATTGATGTTTCTTTGAGGG + Intergenic
960501925 3:118448184-118448206 TAAATCTGATGATTTTTTGGGGG - Intergenic
960740556 3:120828536-120828558 TGAATTTGAAGTTTTCTTTAAGG - Intergenic
962460779 3:135610696-135610718 GAAATCTGATGGTTTCATAAGGG + Intergenic
962912691 3:139868628-139868650 TAAATTTGAACTTTTATTGATGG + Intergenic
963510139 3:146236566-146236588 GAGATTTGATGGTTTCATAAGGG + Intronic
963858206 3:150278745-150278767 TAAATTTGAGCATTTCTTAATGG + Intergenic
964038888 3:152234537-152234559 TAGTTTTAAAGGTTTCTTGAAGG - Intergenic
964517314 3:157526414-157526436 TACTTTTTATGGTTTCATGATGG + Intronic
964580513 3:158230327-158230349 TAACTTTGATCATTTCATGAAGG + Intronic
964789920 3:160444288-160444310 TAAAAGTGATGGCTTCTAGAGGG + Intronic
965471958 3:169104879-169104901 TATATTTTCTTGTTTCTTGATGG - Intronic
966558933 3:181296952-181296974 GAAAATAGATGGTTTCCTGAGGG - Intergenic
967396286 3:189012944-189012966 TGGATTTGTTGATTTCTTGAAGG + Intronic
969071998 4:4547007-4547029 GAAATTTGATGGTTTCATAAGGG + Intergenic
970254978 4:14158402-14158424 TAAATGTGATGATTTCAGGAGGG - Intergenic
971898473 4:32627248-32627270 TTAAATTGATGCTTCCTTGAGGG - Intergenic
972003762 4:34072318-34072340 TAAATTTGGGGGTTTAATGAAGG + Intergenic
972089653 4:35265255-35265277 TCAATTTTATGGTTACCTGAAGG + Intergenic
975017870 4:69446374-69446396 TGAATTTGCTGGTTCCTTAATGG + Intergenic
975903343 4:79179973-79179995 GAGATCTGATGGTTTCATGAGGG - Intergenic
976441222 4:85077135-85077157 TAAATTTGATGTTTTATTTTGGG + Intergenic
976687891 4:87836117-87836139 TAAATATGATGTTTTCTTCCAGG + Intronic
977335825 4:95697782-95697804 TAAATTTGATCATTTATTTAAGG - Intergenic
977450839 4:97194825-97194847 TCAAGTTGATCTTTTCTTGATGG - Intronic
977578929 4:98703779-98703801 GAGATCTGATGGTTTCTTCAGGG + Intergenic
977649804 4:99456358-99456380 TAAATTTGATTGTTTCCTTTAGG - Intergenic
977799776 4:101213164-101213186 TAAATATGATAGTTTTTTTAAGG + Intronic
978188656 4:105887892-105887914 TAAGTTCGCTGGCTTCTTGAAGG + Intronic
978315802 4:107435575-107435597 TAGATTTGGGGGTTTCTTGGTGG - Intergenic
978355846 4:107872795-107872817 TAAATTACATGGTTACTGGAAGG - Intronic
978916691 4:114133830-114133852 TAAATATGATGGTATCCTGTTGG - Intergenic
979040590 4:115787722-115787744 TATATGTGATGGTTTATTTATGG + Intergenic
980875689 4:138659755-138659777 AAAAATTAATGATTTCTTGAAGG + Intergenic
981210296 4:142095397-142095419 TTAATTTGATGTTTCATTGAAGG + Intronic
981308432 4:143270586-143270608 TAAATTTGATGAGTTGATGATGG + Intergenic
983572585 4:169225715-169225737 TAAAAGTGATGGTAGCTTGAAGG + Intronic
984131127 4:175877562-175877584 AACATTTGATGGTTTCATAAGGG - Intronic
984136235 4:175942917-175942939 GAAAGTTAATGGTATCTTGATGG + Intronic
984234860 4:177143157-177143179 AAGATTTGATGGTTTCATCAGGG + Intergenic
984440420 4:179762576-179762598 GAGATTTGATGGTTTCATAAAGG - Intergenic
986685873 5:10274848-10274870 AAGATCTGATGGTTTCATGAGGG - Intergenic
987027372 5:13940857-13940879 TAAATTCCATGGTGTCTAGAAGG + Intronic
987260703 5:16199607-16199629 TGAATTTGTTGATTTTTTGAAGG - Intergenic
987350799 5:17020193-17020215 TAGATCTGATGGTTTCCTAAAGG - Intergenic
988402516 5:30779994-30780016 GAAATTCAATGGTATCTTGATGG - Intergenic
990642388 5:57801751-57801773 TATGTTTGTTTGTTTCTTGAAGG - Intergenic
990720666 5:58692475-58692497 TAAATTTAATGTTATCTTGGTGG - Intronic
992428462 5:76683490-76683512 TAAATTTGGTTCTTTATTGATGG - Intronic
993049496 5:82910198-82910220 TAAAATACATGGTTTCTAGAGGG + Intergenic
994008617 5:94873075-94873097 TAAATTTGATTTATTTTTGAGGG - Intronic
994357102 5:98805296-98805318 TAAATTTGATGTTTCTTTGTTGG - Intergenic
994397854 5:99240947-99240969 TAAAGTTGATGGTTTAGGGAAGG + Intergenic
994495251 5:100504034-100504056 GAAAATTAATGGTATCTTGATGG - Intergenic
994917635 5:106000594-106000616 GAAATTAGATGGTAGCTTGATGG + Intergenic
995075624 5:107979985-107980007 TAAATTTGATCCTTTTTTGTTGG + Intronic
995371311 5:111421893-111421915 GAAATTTGATGGTTTTATAAAGG + Intronic
995494137 5:112723664-112723686 TAAATTAAATGGTTTTTTGTGGG - Intronic
995711828 5:115043540-115043562 GAAAGTTGATGGTAGCTTGATGG - Intergenic
995843897 5:116472607-116472629 TACATTTAATGAGTTCTTGAGGG - Intronic
996036532 5:118764603-118764625 TGAATTTGTTGATTTTTTGAAGG - Intergenic
996121526 5:119679301-119679323 TTAATTTGATAGGTTCTGGATGG + Intergenic
996161399 5:120171209-120171231 TAAATTTGATGGATTATTTCTGG + Intergenic
998307340 5:141092377-141092399 CAAATTTGATTGTTTCCTCATGG - Intergenic
998886075 5:146695179-146695201 TAAATTTGTTTGTTTCTTAATGG - Intronic
999290707 5:150423883-150423905 TATATCTGATTGTTTCTTCATGG - Intergenic
999499765 5:152135159-152135181 TAATTTTGTTTGTTTCTTGGTGG + Intergenic
999565069 5:152850517-152850539 AAAATTTTATCATTTCTTGAAGG + Intergenic
1000571416 5:162918809-162918831 TAATTTTGAGGGTTTTTTTATGG + Intergenic
1000673344 5:164089763-164089785 GAAATTTAATGGTAGCTTGATGG + Intergenic
1000934510 5:167292047-167292069 GAGATTTGATGGTTTTATGAAGG - Intronic
1001685148 5:173588852-173588874 TAAATTTGAGGGTTTATTTCTGG - Intergenic
1003336138 6:5174572-5174594 TAAACTTAATGGTTACTTCAAGG + Intronic
1005527747 6:26667868-26667890 TAAATCTGATGGTTTTATAAGGG - Intergenic
1005543048 6:26833810-26833832 TAAATCTGATGGTTTTATAAGGG + Intergenic
1006217203 6:32454446-32454468 GAGATTTGATGGTTTTATGAAGG + Intergenic
1008038681 6:46774261-46774283 TCAGTTTGATGGTACCTTGAGGG + Intergenic
1008298201 6:49803965-49803987 AAGATTTGATGGTTTCATAAAGG + Intergenic
1008375290 6:50784532-50784554 TAAATATGATGGGTTACTGATGG - Intergenic
1008462891 6:51796453-51796475 TAGATTTGTTGATTTTTTGAAGG + Intronic
1009013866 6:57875980-57876002 TAAATCTGATGGTTTTATAAGGG + Intergenic
1009062483 6:58414341-58414363 TAAAGTTTCAGGTTTCTTGATGG + Intergenic
1009276881 6:61694006-61694028 TAAATTTGATGATATCTGGCAGG - Intronic
1009736954 6:67688633-67688655 GAGATCTGATGGTTTCTTAAGGG - Intergenic
1010906699 6:81500398-81500420 GAAATCTGATGGTTTTATGAGGG + Intronic
1011218753 6:85032670-85032692 AAAATCTGATGGTTTTATGAGGG - Intergenic
1011385662 6:86795622-86795644 GAAATCTGATGGTTTTGTGAGGG - Intergenic
1011586397 6:88930922-88930944 TTACTTGGATGGTTTCTTTATGG - Intronic
1011596621 6:89022792-89022814 TAAAATTGATTGTTTCTAGGTGG - Intergenic
1011620747 6:89240222-89240244 TAGATGTGATGGTTTCCTGCTGG + Intergenic
1012091794 6:94907111-94907133 TACATTAGATGTTTTCATGAAGG - Intergenic
1012102155 6:95103985-95104007 TAACATTGTTCGTTTCTTGATGG - Intergenic
1012655889 6:101819942-101819964 TAAATTTGTTGGCTTTTTAATGG - Intronic
1012706431 6:102537919-102537941 GAAATTTGATGGTTTTATAAAGG + Intergenic
1013174730 6:107667610-107667632 TAAATTGGATGGTTTCCTTCAGG + Intergenic
1013944480 6:115705124-115705146 TAAAATTGATGGTTCTGTGAGGG + Intergenic
1014297080 6:119631807-119631829 TATTTTTAATGGTTGCTTGAGGG - Intergenic
1014875463 6:126654056-126654078 TAGATCTGATGGTTTTATGAGGG + Intergenic
1015396445 6:132739716-132739738 TAAATTTGATGGCTTTTTGAAGG - Intergenic
1016062786 6:139647550-139647572 TCTATTTTATGGTTTCTTGATGG - Intergenic
1016230760 6:141801088-141801110 GAAATCTGATGGTTTCATAAGGG + Intergenic
1016957230 6:149638648-149638670 TATGTGTGATTGTTTCTTGAGGG - Intronic
1018362929 6:163089672-163089694 TAAATTTGAAGTTTTTTTAATGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1020493677 7:8821414-8821436 GAGATCTGATGGTTTCATGAAGG - Intergenic
1020493937 7:8823267-8823289 AAGATTTGATGGTTTTATGAAGG - Intergenic
1020742211 7:12035479-12035501 AAAATTTGATGGTTAATTGAAGG - Intergenic
1021269057 7:18562562-18562584 TAAATGTAATGGTTTCTTTCTGG + Intronic
1021834394 7:24654256-24654278 TATATTTAATATTTTCTTGAAGG + Intronic
1022434811 7:30372721-30372743 TCAATTCCATAGTTTCTTGATGG - Intronic
1023060301 7:36320325-36320347 GAGATTTGATGGTTTCATAAGGG + Intergenic
1023308976 7:38863428-38863450 TAAATTTGAGCGTTTCATTATGG - Intronic
1024328049 7:48128243-48128265 TAACTTTGATCTTTTCTTGGGGG + Intergenic
1024436917 7:49367195-49367217 TATATTTGAGGGTTTCTTTCTGG + Intergenic
1026284131 7:68948258-68948280 TAAATTTGAAGTTTTTTTTATGG - Intergenic
1027619240 7:80462631-80462653 TTCATTTGATGTTTTCTTAAAGG - Exonic
1027729275 7:81849356-81849378 AAAATCTGATGGTTTTTTAAGGG - Intergenic
1027733793 7:81907309-81907331 AAAATTTGATGGTTTTCTAAGGG - Intergenic
1027753174 7:82177706-82177728 AAAGATTGATGGTCTCTTGATGG - Intronic
1028055575 7:86237617-86237639 TAAATCTGATGATTTAATGAAGG - Intergenic
1028267127 7:88739600-88739622 TAAATTAGATGGTTTTTCTAAGG + Intergenic
1031168715 7:118264024-118264046 TAAGTTTGATAGTTTCTTTCTGG - Intergenic
1031225387 7:119031173-119031195 TAAATTTCAGGGTTTCATAAAGG - Intergenic
1031517647 7:122721225-122721247 TGGATTTGTTGGTTTTTTGAAGG - Intronic
1031682501 7:124691831-124691853 TGACATTGTTGGTTTCTTGAGGG - Intergenic
1031964353 7:128017003-128017025 TGAATCTGATGGTTACTTTAAGG - Intronic
1033438814 7:141359936-141359958 GAGATCTGATGGTTTCATGAAGG - Intronic
1034517988 7:151596233-151596255 TAGTTTTGACAGTTTCTTGATGG - Intronic
1038086620 8:24204913-24204935 AAAAGTTGAAGGTTACTTGAAGG + Intergenic
1038859301 8:31369010-31369032 CAAATTTATTGGTTTGTTGATGG + Intergenic
1039599822 8:38826595-38826617 TCATTTGGATAGTTTCTTGATGG + Intronic
1040404924 8:47090980-47091002 AAAATTTGAATGATTCTTGAGGG - Intergenic
1040623539 8:49117588-49117610 AAAATTTGATGGTTTTATAAGGG - Intergenic
1042678000 8:71344014-71344036 AAAATAAGATGGTTTTTTGAAGG - Intronic
1042690119 8:71488837-71488859 TAAATTTTATGCTTGCATGAAGG + Intronic
1042796846 8:72673352-72673374 GAAATCTGATGGTTTTTTAAGGG + Intronic
1043243594 8:77969379-77969401 TAAATTTTATGGTCACTTGAAGG + Intergenic
1043506364 8:80907078-80907100 TACATATAATGGTTTGTTGAAGG - Intergenic
1043535385 8:81197930-81197952 TGACTTTGTTGGTTTATTGAGGG - Intergenic
1044327856 8:90880651-90880673 TACATTTTATTGTTTCTTGGAGG - Intronic
1044508288 8:93046477-93046499 TGAATTTGTTGATTTTTTGAAGG + Intergenic
1044513291 8:93109151-93109173 TTAATTGCATGGTTTCTTGAGGG + Intergenic
1044620064 8:94181127-94181149 TAATTGCTATGGTTTCTTGATGG - Intronic
1044785137 8:95785355-95785377 CAAATTTAATGAATTCTTGAAGG - Intergenic
1046304680 8:112349734-112349756 TAAATTGGATGATTTTTTTAAGG - Intronic
1046347602 8:112954336-112954358 TAAAATTGGTGGTTTCTTGTAGG - Intronic
1046851192 8:118974886-118974908 TAAAGTTTATGGTTTGTTGCTGG + Intergenic
1046852276 8:118988122-118988144 TAAATTTGATAAGTTGTTGAAGG + Intergenic
1047642511 8:126835441-126835463 TAAATTAGTTACTTTCTTGATGG + Intergenic
1048903332 8:139061199-139061221 AAATTTTAATGGATTCTTGATGG - Intergenic
1050142195 9:2527690-2527712 GAGATTTGATGGTTTCATAAAGG + Intergenic
1050940701 9:11453322-11453344 AAAATCTGAAGCTTTCTTGAAGG + Intergenic
1051748017 9:20314017-20314039 TAATTTTGTGTGTTTCTTGAAGG - Intergenic
1052154599 9:25169280-25169302 TGGATTTGTTGATTTCTTGAAGG - Intergenic
1052270612 9:26624661-26624683 TCAATTTGATCGCTTCTTGAAGG - Intergenic
1052288236 9:26812218-26812240 TTAATGTGGTTGTTTCTTGATGG - Intergenic
1052402924 9:28023884-28023906 TAGATTTGATGGATTGTTGGAGG - Intronic
1052768399 9:32665233-32665255 TGAATCTGATGATCTCTTGATGG - Intergenic
1052908839 9:33861726-33861748 TAAACTTGAATGTTTTTTGATGG + Intronic
1053581283 9:39407100-39407122 GAAATTTGATGGTTTTATAAAGG - Intergenic
1054102870 9:60965899-60965921 GAAATTTGATGGTTTTATAAAGG - Intergenic
1054583492 9:66940961-66940983 GAAATTTGATGGTTTTATAAAGG + Intergenic
1055006014 9:71507678-71507700 GAAATCTGATGGTTTTTTAAAGG + Intergenic
1055394713 9:75861806-75861828 TAGCTTTGATGGTGTCTAGAGGG - Intergenic
1055489284 9:76788244-76788266 AACATCTGATGGTTGCTTGATGG - Intronic
1057063223 9:92024433-92024455 AAAATTTGCTGGCATCTTGATGG + Intergenic
1057449532 9:95144374-95144396 TAAATTTTATGAGTTGTTGAGGG + Intronic
1058528276 9:105881780-105881802 TCAGTTGGTTGGTTTCTTGAGGG - Intergenic
1058677375 9:107411995-107412017 TAAATTTGATGTTATCTATATGG + Intergenic
1059775293 9:117468707-117468729 TAAATTTCAAGGTTTCTTTTAGG + Intergenic
1059843582 9:118245928-118245950 GAGATCTGATGGTTTCTTAAAGG + Intergenic
1059887334 9:118760824-118760846 TAATTTTGATGGTTTTGTGAAGG - Intergenic
1060077916 9:120610805-120610827 TTAATTTTTTGCTTTCTTGATGG - Intronic
1060357545 9:122924249-122924271 AAAATTTATTGGTTTCTTAAAGG + Intronic
1060684901 9:125600619-125600641 TCAATTTCATGTTTGCTTGAAGG - Intronic
1186135348 X:6514235-6514257 TAAATCTGATTATTTCTTTAGGG - Intergenic
1187015654 X:15325884-15325906 TGAATTTCATGTTGTCTTGAGGG - Intronic
1187591026 X:20717598-20717620 GAGATCTGATGGTTTCATGAGGG - Intergenic
1187974644 X:24693271-24693293 TACATCTGATTGTTTCTTCATGG + Intergenic
1188013156 X:25079005-25079027 TAAGTTTTAGGGTCTCTTGATGG + Intergenic
1188517960 X:31007800-31007822 GAAATTTGCTGGTTTCTTGCAGG + Intergenic
1189023690 X:37369808-37369830 GAGATCTGATGGTTTCATGAAGG + Intronic
1189203224 X:39215749-39215771 TAAATTTGACAGATTCTTCAGGG + Intergenic
1189917559 X:45871250-45871272 CAAATTGGATGGTTAATTGAAGG + Intergenic
1190239899 X:48649745-48649767 AAAATCTGATGGTTTCATAAGGG - Intergenic
1190520179 X:51270915-51270937 GAAATGTGAGGGTTTCTTGTTGG - Intergenic
1191766279 X:64702168-64702190 TGAATTTGTTGATTTTTTGAAGG + Intergenic
1191788139 X:64939393-64939415 TAAAGTCAATGGTATCTTGATGG - Intronic
1191788280 X:64940934-64940956 TAAATTCAATGGTAGCTTGATGG + Intronic
1192384716 X:70655872-70655894 TAAATATGATGTTTGCTTTAGGG - Intronic
1192423433 X:71053954-71053976 TAAGTGTGATGGTTTATTTATGG + Intergenic
1192721939 X:73708292-73708314 TAACTTTCATGGTTTACTGATGG - Intergenic
1192877331 X:75245472-75245494 TAAATTTGCATGTTTCTTTATGG - Intergenic
1192990532 X:76450017-76450039 TAATTTTTATGATTTCCTGAAGG - Intergenic
1193251624 X:79297869-79297891 GAGATCTGATGGTTTCCTGAGGG - Intergenic
1193813598 X:86081096-86081118 GAAATCTGATGGTTTTTTCAGGG - Intergenic
1193904838 X:87229505-87229527 TAAATTTCAAAGTTTCTTGAGGG + Intergenic
1194074916 X:89378930-89378952 TATATTTTATGATTTATTGATGG + Intergenic
1194152493 X:90343165-90343187 TGAATTTGTTGATTTTTTGAAGG + Intergenic
1194536897 X:95116645-95116667 TGGATTTGTTGGTCTCTTGAAGG + Intergenic
1195147077 X:102028767-102028789 AAAATTTGTTGTTTTCATGATGG - Intergenic
1196066437 X:111469645-111469667 AAGATCTGATGGTTTCATGAAGG + Intergenic
1196246422 X:113404854-113404876 AAGATTTGATGGTTTCATAAGGG + Intergenic
1197233281 X:124029765-124029787 TGGATTTGATGATTTCTTAAAGG - Intronic
1197527150 X:127577366-127577388 TAAATCTGATGGTTTTATAAAGG - Intergenic
1199044122 X:143148449-143148471 GAGATTTGATGGTTTCATAAGGG + Intergenic
1199185607 X:144911730-144911752 CAAATATGATGGTTTTTTAAGGG - Intergenic
1199397208 X:147352778-147352800 TAGATTTGTTGTTTTTTTGAAGG - Intergenic
1199565954 X:149216100-149216122 GAAATTTGATGGTTTTATAAAGG + Intergenic
1200498842 Y:3919914-3919936 TGAATTTGTTGATTTTTTGAAGG + Intergenic
1200730515 Y:6733101-6733123 TATATTTTATGATTTATTGATGG + Intergenic
1200988803 Y:9328937-9328959 TAAATTTGATGCTTTTTTTGGGG - Intergenic
1201237787 Y:11928216-11928238 GAAATCTGATGGTTTTATGAGGG + Intergenic
1201618890 Y:15932975-15932997 TAAATCTGATGATTTCTTTAGGG - Intergenic
1201645572 Y:16226559-16226581 TAAATTTGAAGCTTGTTTGATGG + Intergenic
1201657241 Y:16358755-16358777 TAAATTTGAAGCTTGTTTGATGG - Intergenic
1201941076 Y:19460836-19460858 TAAATGTGGTGGCTGCTTGAGGG - Intergenic
1202110475 Y:21411631-21411653 TAAATTTGATGCTTTTTTTGGGG - Intergenic
1202117983 Y:21492435-21492457 TAAATTTGATGCTTTTTTTGGGG + Intergenic
1202186362 Y:22188167-22188189 TAAATTTGAGGCTTTCTTTGGGG - Intergenic
1202204997 Y:22398229-22398251 TAAATTTGAGGCTTTCTTTGGGG + Intronic