ID: 951035614

View in Genome Browser
Species Human (GRCh38)
Location 3:17928702-17928724
Sequence GTGGAAACCCAGATTTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951035614_951035617 -9 Left 951035614 3:17928702-17928724 CCCTTATAAATCTGGGTTTCCAC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 951035617 3:17928716-17928738 GGTTTCCACCTGGCTCAGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 132
951035614_951035620 11 Left 951035614 3:17928702-17928724 CCCTTATAAATCTGGGTTTCCAC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 951035620 3:17928736-17928758 TGGAAGCCACATCTTGTTCAAGG 0: 1
1: 0
2: 2
3: 16
4: 172
951035614_951035621 12 Left 951035614 3:17928702-17928724 CCCTTATAAATCTGGGTTTCCAC 0: 1
1: 0
2: 1
3: 13
4: 179
Right 951035621 3:17928737-17928759 GGAAGCCACATCTTGTTCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951035614 Original CRISPR GTGGAAACCCAGATTTATAA GGG (reversed) Intronic
901279223 1:8019654-8019676 GGGGAGAAGCAGATTTATAAAGG + Intronic
905497205 1:38401649-38401671 ATGGAAACCTAGATATATTAGGG + Intergenic
907420750 1:54345605-54345627 GTGGAAACCAAGGATTTTAAAGG - Intronic
912981629 1:114379286-114379308 GTGGAGAACCAGATTAAAAAAGG - Intergenic
914938278 1:151999839-151999861 GTGGAGACCCAGGTTCATAGTGG - Intergenic
921423025 1:214970744-214970766 GTGGAAAAACTGATTTATGAGGG + Intergenic
922031414 1:221803367-221803389 GTGGAATGGCAGATTGATAATGG - Intergenic
922309110 1:224371372-224371394 GTGGAAACCAAGCTTGATCATGG - Exonic
923289974 1:232535352-232535374 GTGAAAATAGAGATTTATAATGG - Intronic
923940816 1:238823671-238823693 GTGAAAACCCAGAATTAGGAAGG - Intergenic
924661466 1:246022490-246022512 GAGGAAACCAAGATTTACAGAGG - Intronic
1065768367 10:29053405-29053427 GTGGGATCCCTGATTTATAGTGG - Intergenic
1067671321 10:48324799-48324821 GGGGAAACCCATTGTTATAATGG - Intronic
1068220117 10:54033305-54033327 GTGGAAGTACAAATTTATAAGGG - Intronic
1068229534 10:54153841-54153863 TTGCACACCCTGATTTATAAAGG + Intronic
1068243339 10:54334413-54334435 GTGCAAACCCATATTAGTAAAGG - Intronic
1069225953 10:65944371-65944393 GTGGAGAAGCAGATGTATAATGG + Intronic
1070788735 10:79177265-79177287 GTGGAAACACAGACTTGAAAAGG - Intronic
1071750215 10:88466999-88467021 CTTAAAACTCAGATTTATAATGG + Intronic
1071945268 10:90636802-90636824 GAGGAAACCTAGATTCATAGAGG - Intergenic
1073657238 10:105429861-105429883 GTTGAAACCCAGATTTCTCCAGG - Intergenic
1073831262 10:107386032-107386054 TTGGTAACCTAAATTTATAAAGG + Intergenic
1074009575 10:109463609-109463631 GTGGAAACTGAGGTTTATGAAGG + Intergenic
1074629987 10:115242236-115242258 ATGGAAACCCAGATGTATCTGGG + Intronic
1075323004 10:121507262-121507284 GAGGAAACCCAGGTCTAGAAAGG - Intronic
1078759937 11:14243758-14243780 GTGGAAAGCCAGATTTACCCTGG + Intronic
1079137507 11:17784215-17784237 CTGGAAACCCATATTCCTAACGG - Intergenic
1079373599 11:19872641-19872663 GTGCAAACCCAGCTTTAGACTGG - Intronic
1080105213 11:28504455-28504477 ATGAAAATCCAGATTTCTAATGG - Intergenic
1081714643 11:45240700-45240722 GTGGAATCACAGATTAATGAGGG + Exonic
1083421971 11:62558736-62558758 GTGGTATCCCTGATTTCTAACGG - Intergenic
1085200026 11:74696319-74696341 GTGGAAACCAAGATCCAGAAGGG - Intergenic
1086269390 11:85042455-85042477 GTGAAAACTAAGATTTAAAATGG + Intronic
1086766964 11:90707512-90707534 ATGGAATCCCAAGTTTATAATGG + Intergenic
1089188594 11:116637724-116637746 GTGGAATCCCAGCCTTAAAATGG - Intergenic
1089270981 11:117300996-117301018 GGCGAAACCCAGTTTTAGAATGG - Intronic
1091678157 12:2506413-2506435 GGGGAAACTAAGATTTAAAAAGG - Intronic
1092090720 12:5801711-5801733 GAGGAAACCCAGATACAAAAGGG + Intronic
1093116875 12:15222182-15222204 AAGAATACCCAGATTTATAAGGG - Intronic
1093288156 12:17291587-17291609 GTGGAAACACAGAGTAATCATGG - Intergenic
1093842737 12:23924405-23924427 ATGGGAAGCCAGATTTACAAAGG + Intronic
1095276151 12:40284997-40285019 TTGGAAACCTTGATGTATAAAGG - Intronic
1095754639 12:45750838-45750860 GAGGAAACTAAGATTTAGAAAGG + Intronic
1098824764 12:75282324-75282346 GTTGAAATCCAGTTTCATAAAGG + Exonic
1098841885 12:75487415-75487437 GCGAAAGCCCAGTTTTATAAGGG - Intronic
1098869056 12:75796335-75796357 GTGGAGACCCTGATACATAAGGG - Intergenic
1106563720 13:30868238-30868260 GAGGACACCCAGGTTTAGAAAGG - Intergenic
1106952131 13:34895968-34895990 TTGGAAACCAAAATTGATAAAGG + Intergenic
1107054878 13:36092248-36092270 GAGGAAACTGAGATTTAGAAGGG - Intronic
1107056087 13:36105222-36105244 GTGAAAAGCCACATTTACAAAGG + Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1115079682 14:29435860-29435882 GTGGTAACCCAGAATATTAACGG - Intergenic
1118750495 14:68804327-68804349 GTGGAGACCAAGATTTCAAAAGG - Intergenic
1119713439 14:76840520-76840542 AAGGAAACCTATATTTATAATGG - Intronic
1121682601 14:95806250-95806272 GTGGAAACCCAAAGTCACAAAGG - Intergenic
1122164774 14:99814159-99814181 ATGGAAACCTAGAGTTGTAAAGG + Intronic
1122308571 14:100780612-100780634 ATGGGGACCCAGCTTTATAAAGG + Intergenic
1126881011 15:53097630-53097652 GTGGAAATCCAGTTTTTTAGTGG + Intergenic
1128527137 15:68420267-68420289 GTGAAAACCTAGTTATATAATGG - Intronic
1128981466 15:72190470-72190492 GTGGAGATCCAGTTTTATTAAGG - Intronic
1130673925 15:85935973-85935995 GTGGCAACTCAGATTTCTAGGGG + Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132677321 16:1126162-1126184 GTGGAAACCCAGTTTTAGACCGG + Intergenic
1135968636 16:27055937-27055959 GAGGAAACCCAGACTGAGAAAGG + Intergenic
1149812079 17:59685483-59685505 TTGCAAAACCAGATTTATATTGG + Intronic
1153003694 18:479151-479173 GATGAAACCAAGAATTATAAAGG - Intronic
1155172797 18:23279556-23279578 GTGGAAACCTAGTTCTATGAAGG + Intronic
1157999258 18:52597051-52597073 GTGGAGACTCAGATTCAAAAGGG - Intronic
1159529756 18:69640456-69640478 TTGGAAACACAGATTCCTAATGG - Intronic
1164924545 19:32119330-32119352 GGAGAATCCCAGGTTTATAAAGG + Intergenic
1166498314 19:43322010-43322032 GTGAAATCCTTGATTTATAAAGG + Intergenic
1168571209 19:57472194-57472216 GCAGAAACCCAGATTAATAAAGG - Exonic
927092426 2:19722255-19722277 TTGGAAGCCTAGTTTTATAAGGG + Intergenic
927375830 2:22412446-22412468 GTGGAAACCCACATTTGGAGTGG - Intergenic
928693949 2:33829808-33829830 GTGGAGAACCACCTTTATAAAGG + Intergenic
930305367 2:49668622-49668644 GTGGAAACTTATATTTAAAATGG - Intergenic
933423741 2:82084724-82084746 GTTGAAACCCACATTAAAAATGG - Intergenic
938635364 2:133219588-133219610 TTGGAAACCCACTTTTAAAAGGG - Intronic
939176399 2:138753007-138753029 GGGGAAACATAAATTTATAATGG - Intronic
939229980 2:139412145-139412167 GTGGAATTCCTGAATTATAAGGG + Intergenic
940792273 2:158041990-158042012 CTGGAAATCCAGATTTATAAAGG - Intronic
940897911 2:159098621-159098643 GTGAAAACTCAGACTTGTAAAGG + Intronic
942187099 2:173434271-173434293 GTCTAAACCCAGATTTAGTAAGG + Intergenic
942542988 2:177034006-177034028 GAGGAAAAGCAGATTTCTAAAGG - Intergenic
944499954 2:200349290-200349312 GAGGAAACCGAGATCTAGAAAGG + Intronic
944586920 2:201180625-201180647 GAGGAAACCCAGATTCAGAGAGG - Intergenic
944805387 2:203276093-203276115 GTGGATACCCAGATGTTCAAAGG + Intronic
946726677 2:222668362-222668384 GTGGAATCCCAGATCTTCAAAGG + Intergenic
947249773 2:228089417-228089439 GTTGAAACTCATATTTAAAAGGG + Intronic
947788812 2:232850008-232850030 GTGGAAACCCAGAGTTAACCAGG + Intronic
1169909600 20:10636705-10636727 GTGGAAACCCAGCTGTCTACTGG + Intronic
1170086670 20:12541010-12541032 GGGTAAACCCAGATTTATCATGG + Intergenic
1170518958 20:17163248-17163270 GTGGAAACATTGATTTATAGTGG + Intergenic
1170825877 20:19794872-19794894 GAGGAAAGCCAAATTTATGAAGG - Intergenic
1173708262 20:45130713-45130735 GTGTAAAACCAGGTTTACAATGG + Intergenic
1178573080 21:33758876-33758898 GTGGAAACCTAGGTACATAAAGG - Intronic
1178686470 21:34715183-34715205 GTGGAGACCCAGAGCCATAAAGG - Intronic
1178701818 21:34840365-34840387 GTAGAAAAGCAGATTTAGAATGG - Intronic
1180080509 21:45485671-45485693 GTGGAGACCCAGACCTAGAAGGG + Intronic
1181529197 22:23506872-23506894 GTGGAAACCCAGATTGGTGCCGG + Intergenic
1182175380 22:28280698-28280720 ATGGAAACCCAGACCTACAAGGG - Intronic
949278303 3:2314551-2314573 GATGAAACTCAGATTTATTAAGG + Intronic
949741281 3:7237412-7237434 CTGGATACCCAGATTTTAAAGGG - Intronic
950554189 3:13685385-13685407 GTGGAAACCCAAATTTGTATGGG - Intergenic
951035614 3:17928702-17928724 GTGGAAACCCAGATTTATAAGGG - Intronic
951768060 3:26222549-26222571 GTGGACAACCAGACTTAAAATGG - Intergenic
952540338 3:34360725-34360747 ATGGAAAAACAAATTTATAATGG - Intergenic
953718828 3:45337853-45337875 GTGGAAACCTAGATTTTAGATGG - Intergenic
954041253 3:47889120-47889142 GAGGAAATACAGATTTTTAAAGG + Intronic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
955747341 3:62153258-62153280 GTGTAAGCCCAGATTTATCAAGG - Intronic
956096515 3:65721995-65722017 GTGGAAAGCAAGACTTGTAAGGG - Intronic
956625659 3:71264050-71264072 CAGGAAACCCAGATTCAGAAAGG + Intronic
957435546 3:80170752-80170774 GTTGAAAGCATGATTTATAAAGG + Intergenic
958254078 3:91304276-91304298 AAGGAAACCAAGATTTAGAAAGG + Intergenic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
958626787 3:96636127-96636149 GAGCAGACCCAGATTTAAAAAGG + Intergenic
961415911 3:126756535-126756557 AGGGAGACCCGGATTTATAAAGG - Intronic
962679412 3:137783207-137783229 GTTGGAACCTAGAATTATAAGGG - Intergenic
963515565 3:146304047-146304069 GGGAACACCCAGATATATAAAGG + Intergenic
963867845 3:150382143-150382165 GTGGAAATACAGATTTGTAGTGG - Intergenic
967269168 3:187718849-187718871 ATGGAAACCCAGATTTCAAAGGG + Intronic
967340877 3:188396677-188396699 GTGGAAATCTGGATTTGTAAAGG - Intronic
971294982 4:25379934-25379956 GTGGAAATGGAGATTTAGAATGG + Intronic
972711229 4:41597049-41597071 GTGAAAACCCAGATCTATGGTGG - Intronic
974756931 4:66221677-66221699 TTTGAAACCCAGATTTTTGATGG + Intergenic
980194049 4:129565162-129565184 CTGGAACCCGAGTTTTATAAAGG + Intergenic
982236091 4:153252423-153252445 GTGGAAATTGAGATTTAGAAAGG - Intronic
983042835 4:162950918-162950940 GTGTAAATCCTGATTGATAAAGG - Intergenic
983143759 4:164187403-164187425 TTGGAAATCCAGACTTATAAGGG - Intronic
983472837 4:168177429-168177451 GTGGATACTCAGTTTGATAAGGG + Intronic
985105890 4:186499923-186499945 TTGGAAACCCAGCTTTATCTCGG - Intronic
985325067 4:188757704-188757726 GAGGAAACCGAGGCTTATAATGG + Intergenic
985885114 5:2671331-2671353 GTGGAAACCTGCATTTGTAAGGG + Intergenic
989040915 5:37228265-37228287 GTGGAAACTCAAATTTAAATAGG - Intronic
990822382 5:59857200-59857222 GTGTAAACCCAGATTGACCAAGG - Intronic
992259557 5:74956200-74956222 ATGGAAAGCGAGAATTATAAGGG - Intergenic
993030643 5:82701658-82701680 ATGGTAACTTAGATTTATAAAGG - Intergenic
997428958 5:133824269-133824291 GTGGGAACCCTCATTTATAGTGG - Intergenic
998389460 5:141778299-141778321 GTGGGAAGGCAGATTTATAGGGG - Intergenic
998531228 5:142886810-142886832 ATGGAATCCCAAATTTATCATGG - Intronic
998800297 5:145862375-145862397 GTGGTAACCCAGAATAAGAATGG - Intronic
998997514 5:147881723-147881745 GTGGAAATGCACATTTACAAGGG - Intronic
999959612 5:156740524-156740546 GTGGCAACACAGAAGTATAATGG + Intronic
1000173148 5:158723711-158723733 GAGGAAACTGAGATTTATACAGG - Intronic
1001871329 5:175158488-175158510 GTGTAAAAACAGAATTATAATGG + Intergenic
1002830142 6:813086-813108 GTGTAAATGCATATTTATAATGG + Intergenic
1003658706 6:8040216-8040238 GAGAAAACCGAAATTTATAATGG - Intronic
1004256318 6:14068007-14068029 GTGGAGACCCTGATCTACAAGGG + Intergenic
1006467387 6:34203750-34203772 GTAGAACCCCAGATTTATTGGGG + Intergenic
1009190416 6:60622798-60622820 AAGGAAACCAAGATTTAGAAAGG - Intergenic
1011008609 6:82677716-82677738 ATTAAAACCCAGAATTATAATGG - Intergenic
1011317035 6:86046029-86046051 GTGGAAAATAAGATATATAAAGG - Intergenic
1011780324 6:90782102-90782124 GAAGAAACCAAGATTCATAAAGG + Intergenic
1012320601 6:97840114-97840136 GTGGAAACTAAGATTGAGAACGG + Intergenic
1014311739 6:119812293-119812315 ATGGAAAAGCAGATTTATCATGG - Intergenic
1014534763 6:122601656-122601678 GTGGAAATCCATCATTATAAAGG - Intronic
1016260821 6:142167994-142168016 GTGTAAAATCACATTTATAAAGG + Intronic
1017082179 6:150680582-150680604 GTGGAAAACCAGGATTCTAAGGG + Intronic
1017759723 6:157558667-157558689 GTGGAAAAACAGAATCATAAGGG - Intronic
1020586008 7:10068878-10068900 GAGGAAATACAGATTTTTAAAGG + Intergenic
1020879320 7:13739079-13739101 GGAAAAACACAGATTTATAAAGG + Intergenic
1021684241 7:23167022-23167044 GTTGCAACGCAGAATTATAAAGG + Intronic
1022188367 7:27992239-27992261 GTGAAAACCAATATTTATAAGGG - Intronic
1022237565 7:28476915-28476937 GTGGAAAAGCAGAATTTTAATGG - Intronic
1028474726 7:91240601-91240623 TTGGAAACCCATATTTCTAATGG - Intergenic
1028974739 7:96899846-96899868 GTGGAAAACCAAAGTTAAAATGG - Intergenic
1030825230 7:114147831-114147853 GTGGAAACCCAGATTGGGAAGGG + Intronic
1031707358 7:124997355-124997377 GTTGCAACCCAGCTTTTTAAAGG - Intergenic
1033484765 7:141777698-141777720 ACATAAACCCAGATTTATAAAGG + Intronic
1035426059 7:158774650-158774672 GAGGAAACGAAGATTTAAAAGGG + Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1041778325 8:61549361-61549383 GTTGAAACTAAGGTTTATAAAGG + Intronic
1043335484 8:79171227-79171249 GTGAAAACTGAGATGTATAAGGG + Intergenic
1045413740 8:101945711-101945733 GTGGAAGACAAGTTTTATAATGG + Intronic
1052900942 9:33794631-33794653 ATGGTAACCCAGATTTACCATGG + Intronic
1054954814 9:70897450-70897472 GTGAAAACTGAGATGTATAAGGG + Intronic
1055856153 9:80691097-80691119 GTGGCAACTTACATTTATAAGGG + Intergenic
1057748102 9:97768021-97768043 GTAGGCACCCAGATTTATAACGG + Intergenic
1060982933 9:127803841-127803863 GTGGAACCCCAGAGTCATGAGGG + Intronic
1061812175 9:133168563-133168585 TTGGAAACCCAGATTTGTGATGG - Intergenic
1186837068 X:13448740-13448762 CTGGGATCCCAGATGTATAAAGG - Intergenic
1188031881 X:25273400-25273422 GTGGAAACTGAGACTTAGAAAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1190392754 X:49948320-49948342 GTTGAGTCCCAGATCTATAAAGG + Intronic
1191148878 X:57198854-57198876 GTGAAAATCCAGATTAAGAAAGG - Intergenic
1192670497 X:73135392-73135414 GTGAAATCCAAGATTTCTAAAGG - Intergenic
1194693428 X:97014518-97014540 GTGGATGCCAAGATTTATACTGG - Intronic
1194761922 X:97804957-97804979 GAGGAAACCGAGGTTTAAAAAGG + Intergenic
1195959948 X:110376035-110376057 GTGGAAACTGAGATTCAGAAAGG + Intronic
1196406733 X:115370738-115370760 GAGGAAACCGAGACTGATAATGG + Intergenic
1197514759 X:127412216-127412238 CAGGGAACCCAGATCTATAAAGG + Intergenic
1199203518 X:145121215-145121237 TTGAAAACTCAGGTTTATAAAGG + Intergenic
1202020583 Y:20460940-20460962 ATGAGCACCCAGATTTATAAAGG - Intergenic