ID: 951035795

View in Genome Browser
Species Human (GRCh38)
Location 3:17930601-17930623
Sequence CTGGCTGCTGACTGTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951035787_951035795 15 Left 951035787 3:17930563-17930585 CCTGAACTGAAGGATGTTCTGTG 0: 1
1: 0
2: 1
3: 16
4: 160
Right 951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG 0: 1
1: 0
2: 1
3: 31
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951035795 Original CRISPR CTGGCTGCTGACTGTTGGGT GGG Intronic
900278916 1:1852768-1852790 CTGGCTCCTGAGTGTAGGGTAGG - Intronic
900476363 1:2878204-2878226 CTGGCTGCTGGCTGTTGTGGGGG + Intergenic
900553972 1:3270616-3270638 CTGGATGAGGACAGTTGGGTAGG + Intronic
900985298 1:6069687-6069709 ATGGCTGCTGCGTGTGGGGTGGG - Intronic
901069637 1:6510697-6510719 CTGCTTGCTGGCTGGTGGGTTGG - Intronic
901601135 1:10424174-10424196 GTGGATGCTGGCTGTTGGCTGGG + Intergenic
903667692 1:25017905-25017927 CAGTCTGCTGTCTGTAGGGTGGG + Intergenic
904565277 1:31424957-31424979 GTGGCTCCTGAGTGGTGGGTAGG - Intronic
908387181 1:63653789-63653811 CTGGCTCCTGCTTGTTAGGTTGG + Intronic
908930421 1:69311646-69311668 GAGGCTGCTGACCCTTGGGTGGG + Intergenic
912189233 1:107318275-107318297 ATGGCTACTGACTAGTGGGTGGG - Intronic
914400714 1:147317293-147317315 GAGGCTGCTGACTCTTGGATGGG - Intergenic
915081514 1:153355756-153355778 CTGGCTGCTGGCTGCTGGCTGGG + Intergenic
915527955 1:156487737-156487759 CTGGCTCCTGCCAGTTGGTTAGG - Intronic
916114106 1:161472874-161472896 CTGGCTGCCGACTGCTGGGTTGG - Intergenic
916115161 1:161479848-161479870 CTGGCTGCCCACTGCTGGCTTGG - Intergenic
916166137 1:161968852-161968874 CTGGCTGCTGATGTTGGGGTGGG + Intergenic
916489164 1:165286343-165286365 CTGGCTGCTGTCTTTCAGGTGGG - Intronic
917662709 1:177193206-177193228 GTGGCTTCTGACTGTAGGGTAGG - Intronic
919270090 1:195330203-195330225 CTGGAGTCTGACAGTTGGGTTGG - Intergenic
919499291 1:198315675-198315697 CTGGTTGCTGACGGTTAGGCAGG + Intronic
919738612 1:200969335-200969357 GGGGCTGCTGACTTTTGGCTGGG - Intergenic
920120786 1:203655804-203655826 ATGGCTGCTTGCTGATGGGTGGG - Intronic
922625140 1:227032777-227032799 CTGGGTGCTGGCTGTTAGCTGGG - Intronic
923086219 1:230705447-230705469 CTGGCGGCTGGCGGCTGGGTGGG - Intronic
1063254560 10:4312024-4312046 GTGGCTGCTGGCTGCTGGGTAGG - Intergenic
1063372391 10:5530294-5530316 CTGGGTGCTGAGTACTGGGTGGG + Intergenic
1063939078 10:11108419-11108441 CTTGCTTCTGACTGCTGCGTGGG + Intronic
1064147354 10:12836027-12836049 CTGGCTGCTGTCTTTTGTGGGGG + Intergenic
1064288378 10:14012135-14012157 ATGGCTGCTGGATGTGGGGTGGG + Intronic
1064650335 10:17502655-17502677 ATGGATGCTGGCTGTTGGCTGGG - Intergenic
1066051055 10:31636094-31636116 CTGGCTGCTGAGCGGTGGGGTGG - Intergenic
1067080199 10:43208442-43208464 CTGGCTGCTGACCAGTGGGCTGG - Intronic
1069950415 10:72014744-72014766 CTGGCAGCTGAGGGGTGGGTGGG - Intergenic
1070822873 10:79372975-79372997 CTGGCTGCTTTCTCTTGGGAGGG - Intergenic
1072889852 10:99314031-99314053 GTGGCTGCTGAAGGTTGGGGTGG - Intergenic
1073588653 10:104735165-104735187 CTGCCTGGTGACTGTCGGCTGGG + Intronic
1075007400 10:118840797-118840819 TTGGCTGGTGTGTGTTGGGTGGG + Intergenic
1075302014 10:121333312-121333334 CTGGCTGCTGTGTGGTGGATGGG + Intergenic
1075478736 10:122760413-122760435 TTCCCTGCTGACTGCTGGGTGGG + Intergenic
1076588611 10:131568258-131568280 CTGCCTGCTGAAGGTTGGATGGG - Intergenic
1077936663 11:6795242-6795264 ATGGCTGCTGGCTCTTGGGCTGG - Exonic
1079276373 11:19040956-19040978 GAGGCTGCTGACTTTTGGATGGG - Intergenic
1080047019 11:27820190-27820212 ATGGTTGCTGAATGTTGGGGTGG - Intergenic
1080423722 11:32137356-32137378 CTGGCTGCTAAATATTGGATAGG + Intergenic
1081340034 11:41917219-41917241 ATAGCTGCTGACTCTTGGATGGG + Intergenic
1081869243 11:46375839-46375861 CCGGCTGCTGGCTGTCGGGCAGG - Exonic
1081889596 11:46529674-46529696 ATTCCTGCTGACTGTTAGGTGGG + Intronic
1082230126 11:49753937-49753959 GTGGCTGCTGAATGTTTGGGTGG - Intergenic
1083490175 11:63009883-63009905 CAGGTTGCTGACTGTGGGGGAGG + Intronic
1083637221 11:64127299-64127321 CTTGCTGCTGACTCTCGGCTTGG + Intronic
1083970636 11:66071768-66071790 CTGTCTCCTCACTGTTGGTTAGG + Intronic
1084318001 11:68356552-68356574 CAGGATGCTGACAGTTGGGAAGG - Intronic
1084459758 11:69290033-69290055 TTTCCTGCTGACTGTTGGCTGGG + Intergenic
1085066414 11:73499359-73499381 GAGGCTGCTGACTCTTGGATGGG - Intronic
1085910218 11:80815721-80815743 CTGTCTGCTGAATGTAAGGTGGG - Intergenic
1086619926 11:88875010-88875032 GTGGCTGCTGAATGTTTGGGTGG + Intronic
1089397870 11:118147629-118147651 CTGGCTGCAGACTGGAGAGTGGG - Intronic
1089571034 11:119409923-119409945 GTGGATGGTGGCTGTTGGGTGGG + Intergenic
1089911590 11:122105951-122105973 CTAGCAGCTGACTTTTGGTTTGG - Intergenic
1089932053 11:122322710-122322732 CTGGGTTCTGACTGATGAGTTGG - Intergenic
1090321280 11:125845470-125845492 GAGGCTGCTGACTTTTGGCTGGG - Intergenic
1092796654 12:12117069-12117091 GTGGCTTCTGACTTTTGGGATGG - Exonic
1093340357 12:17966735-17966757 GAGGCTGCTGACTTTTGGATGGG + Intergenic
1094370922 12:29736948-29736970 CTGTCTGCTGAATGTTACGTTGG - Intronic
1098367354 12:69718824-69718846 CTGGATGCTGACTCTGGAGTGGG + Intergenic
1098981742 12:76963475-76963497 CTGGCTGCAGACTGTTAGAGGGG - Intergenic
1100723360 12:97382382-97382404 TTGGTTGCTGAATGTTGGGGTGG + Intergenic
1101186779 12:102289169-102289191 GAGGCTGCTGACCTTTGGGTGGG + Intergenic
1101562274 12:105868841-105868863 GTGGCTGCTGAAGGTTGGGGTGG - Intergenic
1103294081 12:119871206-119871228 GTGGGTGCTGACTGCTGGCTGGG - Intronic
1104723519 12:131060481-131060503 CTGGCTGTTAACTGCTGGCTGGG + Intronic
1105021409 12:132819031-132819053 CTAACTGCTGACTGGTGGGTGGG + Intronic
1105898851 13:24740258-24740280 CTCGCTCCTGTCTGTTGTGTGGG + Intergenic
1106480749 13:30135370-30135392 CTGGCTGCTGGCTGTAGAATGGG + Intergenic
1106762183 13:32878174-32878196 TTGGCTGCTGACAGTTCGGACGG - Intergenic
1108160513 13:47633301-47633323 GAGGCTGCTGACTCTTGGATGGG - Intergenic
1108867141 13:54937652-54937674 CTGGCTGCTTCCTGCTGGGAAGG + Intergenic
1109968861 13:69738230-69738252 GAAGCTGCTGACTGTTGGATGGG - Intronic
1112037868 13:95514397-95514419 CTGGCTCCTGAGGGTGGGGTGGG - Intronic
1112622849 13:101069528-101069550 GTGGCTGCTGAAGGTTGGGGTGG + Intronic
1112943463 13:104895031-104895053 CTGGTTTCTCACTGTTGGGGTGG - Intergenic
1113567185 13:111326174-111326196 CTGGCTGGTGTCTGCTGGGGTGG + Intronic
1115280302 14:31654365-31654387 GTAGTTGCTGAATGTTGGGTTGG + Intronic
1116428731 14:44821094-44821116 GAGGCTGCTGACCTTTGGGTGGG - Intergenic
1118260254 14:64239617-64239639 CTGTCTGTTGGGTGTTGGGTAGG + Intronic
1118518208 14:66550714-66550736 GTGGCTGCTGAAGGTTGGGGTGG - Intronic
1119262462 14:73245776-73245798 CTGGCCGCGGGCTGCTGGGTTGG + Intronic
1119978132 14:79048699-79048721 GTGGCTGCTGAAGGTTGGGGTGG + Intronic
1120592475 14:86391693-86391715 ATGGCTGCTGAAAGTTGGGGTGG + Intergenic
1120669408 14:87347008-87347030 CTGGCTGCTGACCTTTGATTTGG + Intergenic
1121261206 14:92567479-92567501 TTGGGTGCTGGCTGTTGGCTGGG + Intronic
1121557742 14:94851079-94851101 CAGGTTGCTGGCTGTTGGATGGG + Intergenic
1121741095 14:96252880-96252902 CTGGGTGCTGGCTCTGGGGTGGG - Intronic
1122054069 14:99080517-99080539 CTTGCTGCTGGCTGTTGGCTGGG - Intergenic
1122662318 14:103305306-103305328 GTGGCTGCTGAAGGTTGGGGTGG + Intergenic
1122927901 14:104917234-104917256 ATGGCTGCTGACTGATAGGGTGG + Intergenic
1124608619 15:31192508-31192530 CTGGCTGCTGGCTGCTGGCTGGG + Intergenic
1125373294 15:39000762-39000784 GAGGCTGCTGACTTTTGGATGGG - Intergenic
1125423321 15:39526054-39526076 CTGGCTGGGGAAGGTTGGGTGGG + Intergenic
1125539213 15:40459994-40460016 CTGGCTGCTAACTGGAAGGTAGG + Intronic
1126151104 15:45524155-45524177 GTGGCTGCTGAAGGTTGGGGTGG + Intergenic
1126951444 15:53885991-53886013 AAGGTTTCTGACTGTTGGGTTGG + Intergenic
1128528512 15:68428728-68428750 CAGGTTGCTTTCTGTTGGGTAGG + Intronic
1129658540 15:77540549-77540571 GTGGATGCTGACTGTGGGCTGGG - Intergenic
1132549215 16:547470-547492 CTGGCTGGTGGCTGGGGGGTTGG - Exonic
1132744682 16:1431745-1431767 CTGGATGGGGACTGTGGGGTGGG - Intergenic
1133153879 16:3858060-3858082 CTGCATGCAGACTGTTAGGTGGG + Intronic
1133223307 16:4328390-4328412 CTGGCTGCTGCCGGTCGGGGCGG + Intronic
1133278035 16:4649767-4649789 CTGGATGCTGGCTGATGGGCTGG + Intronic
1133851934 16:9513238-9513260 TTGGCTGCTCACTGTAGGTTTGG - Intergenic
1133905245 16:10016331-10016353 CTGTGTGCTGATTGTTGGATGGG - Intronic
1135976723 16:27113333-27113355 CAGGCTGCTGTCTGGAGGGTGGG - Intergenic
1137232737 16:46582605-46582627 CTGGCTGCTGGCTGTTTGCTGGG - Intronic
1137574189 16:49587567-49587589 CAGGCAGCTGGCTGTTGGGGTGG + Intronic
1139280956 16:65770055-65770077 CTGGCTTCTGACTGATGGCTAGG + Intergenic
1139974143 16:70795641-70795663 CTGCCTGCTGGCTGTGGGGGAGG - Intronic
1140156967 16:72440186-72440208 GTGGCTGCTGAAGGTTGGGGTGG + Intergenic
1140777178 16:78260321-78260343 CAGGCTGCTGACCTTTGGATGGG - Intronic
1140837239 16:78806525-78806547 ATTGATGCTGACTGGTGGGTGGG + Intronic
1140884495 16:79230971-79230993 CTGGCTGCAGCTTGTCGGGTTGG + Intergenic
1141581345 16:85001508-85001530 CAGGCTTCTCACTGTTGGGGTGG + Intronic
1141651511 16:85395540-85395562 CTGGGTGCTGGCTGCTGGGAGGG - Intergenic
1141781776 16:86167269-86167291 CTCGGTGCTGGCTGTTGGCTGGG - Intergenic
1142235658 16:88921412-88921434 CTGGCTGGTGACGGATGGGGTGG + Intronic
1142904995 17:3035482-3035504 CTGCCTGCTGCCTCTTGGGAGGG + Exonic
1142968495 17:3595753-3595775 CCGGCTGCTTCCTGTTGGCTGGG - Intronic
1143164100 17:4889407-4889429 CTGACTGCTGCCTGTGGGGTGGG - Intronic
1143631405 17:8142448-8142470 CTGGCTGCTGCCTGTGAAGTGGG + Exonic
1143679541 17:8466003-8466025 CTGGCTGCAGGCTATTGGGTTGG + Intronic
1143994891 17:10997790-10997812 CAGCCTCCTGACTGTTGGTTGGG + Intergenic
1145934857 17:28709169-28709191 CTGTCTACTTACTGTTGGCTGGG + Intronic
1146399901 17:32494246-32494268 CTGGCGGCTGGGAGTTGGGTTGG + Exonic
1146823586 17:36004055-36004077 CTTGCTGCTGACTGCTTGGGGGG + Intergenic
1148803599 17:50250973-50250995 GTGGCTGCTGAAGGTTGGGGTGG + Intergenic
1149499612 17:57142188-57142210 CTGGGTTGTGACTGTGGGGTGGG - Intergenic
1149839396 17:59945710-59945732 ATGGCTGCTTACTTTTGGGAGGG - Intronic
1150548817 17:66190763-66190785 ATGTTTGCTGACTGTAGGGTAGG - Intronic
1151871470 17:76839881-76839903 CTGGCTGCTGGCTGCGGTGTTGG + Intergenic
1152594883 17:81233251-81233273 CTGGCTGCTGACGTGGGGGTGGG - Intronic
1154107344 18:11534091-11534113 CTGGCTGGTAACAGCTGGGTGGG - Intergenic
1154952546 18:21224441-21224463 ATGGCTGCTGACTGATGAGAAGG + Intergenic
1156483783 18:37452055-37452077 CTGCCTCCTGGCTGATGGGTAGG - Intronic
1157682719 18:49619500-49619522 CTGGCTGCTGGGAGTGGGGTAGG + Intergenic
1159121087 18:64172031-64172053 ATGGCTGCTGACTGTGGCGGTGG + Intergenic
1159529214 18:69634643-69634665 TTGGCTGCTGACTCTTTGCTTGG + Intronic
1160223287 18:76992625-76992647 CTGGGTGCTGAATGCTGGGAAGG - Intronic
1161207589 19:3049465-3049487 TTGGCTGCAGCCTGTTGAGTAGG + Intergenic
1161968979 19:7565551-7565573 CTGGCCACTTACAGTTGGGTAGG - Intergenic
1163643748 19:18476538-18476560 CTGGTAGCTGACTGTCAGGTGGG + Intronic
1163699418 19:18779878-18779900 CTGGCTGCTGGCTCCTGGCTGGG - Exonic
1164144220 19:22500616-22500638 CTTCCTGCTGGCTGGTGGGTGGG - Intronic
1164422182 19:28104040-28104062 CTGGCAGCAGAGTGCTGGGTAGG + Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
928193836 2:29198444-29198466 AGGACTGCTGACTGTTGGATGGG - Intronic
928194042 2:29201454-29201476 AGGACTGCTGACTGTTGGATGGG - Intronic
928607455 2:32956159-32956181 CTGGTTGCTGAAAGTTGGGGTGG + Intronic
931995812 2:67838130-67838152 CTGGTGGCTGAATGTAGGGTGGG + Intergenic
932212687 2:69945514-69945536 GTGGCTGCTGGCTGCTGGCTGGG + Intergenic
932579774 2:72985612-72985634 CTGGCTGCTGAGTCCTGGCTGGG - Intronic
934861097 2:97764185-97764207 CTGGCTGCACAGTCTTGGGTGGG + Intronic
934884779 2:98014660-98014682 TGGGCTGGTGACTGGTGGGTTGG - Intergenic
934884792 2:98014699-98014721 GTGGCTGGTGGCTGGTGGGTTGG - Intergenic
935227639 2:101067712-101067734 CTGGCTGCTGAAAGTTGGGATGG + Intronic
935565811 2:104606036-104606058 ATGGCTGCTGACTGATCAGTTGG - Intergenic
936232513 2:110715669-110715691 TTGGCATATGACTGTTGGGTAGG - Intergenic
936377365 2:111953537-111953559 CTTGGTGATGACTGTTGGATGGG - Intronic
936719964 2:115239394-115239416 TTGGTTGCTGAATGTTGGGGTGG - Intronic
937222133 2:120347711-120347733 CTGCCTGCTGCCTGGTGGGGTGG - Intronic
937811322 2:126202600-126202622 CTCACTGCTGGCTGTAGGGTAGG - Intergenic
942295702 2:174515060-174515082 CTGGTTGCAGAATCTTGGGTTGG + Intergenic
944470213 2:200045236-200045258 CTGTCTGGGGACTGTTGGGAAGG - Intergenic
945000948 2:205349962-205349984 CTGGCTGCTTGGTGTTGGCTTGG - Intronic
946474560 2:219994901-219994923 ATGGCTGCTCTGTGTTGGGTGGG + Intergenic
946481394 2:220060239-220060261 CAGGCTCCTGGCTGTTGGCTGGG + Intergenic
947754035 2:232548192-232548214 GTGGCTGCTGAAGGTTGGGGTGG + Exonic
948025433 2:234772521-234772543 CTGCCTGCTGACAGCTGTGTGGG - Intergenic
948182151 2:235990478-235990500 GTTGATGCTGCCTGTTGGGTGGG + Intronic
948375860 2:237519812-237519834 CTGGGGGCTGAGTGTGGGGTTGG + Intronic
948389282 2:237600550-237600572 CAGATTGCTGACTGTGGGGTAGG + Intronic
1168861494 20:1048979-1049001 GTTGATGCTGACTGTTGGCTGGG - Intergenic
1168933409 20:1643727-1643749 CAGGCTGCTGACCCTTGGATGGG + Intronic
1169355421 20:4901183-4901205 CTGGCAGGTGTCTGTTGAGTAGG - Intronic
1170005141 20:11660142-11660164 CTGCTTGCTGGCTGTTGGCTGGG - Intergenic
1170111542 20:12808989-12809011 CTGGCTGCAGTGTGTGGGGTGGG - Intergenic
1170642933 20:18171896-18171918 GTGGCTGCTGAAGGTTGGGATGG - Intronic
1170725479 20:18922519-18922541 GTTGATGCTGACTGTTGGCTTGG - Intergenic
1170921956 20:20687563-20687585 TTGGCTCCAGACTGGTGGGTTGG - Intronic
1171037229 20:21724893-21724915 GTGGCTGCTGACTGTTGACTGGG + Intergenic
1171228455 20:23461066-23461088 GTGGTTGCTGAAGGTTGGGTTGG - Intergenic
1171239008 20:23550352-23550374 CAGGCTGCTGAGTGATGGGCAGG - Intergenic
1172390102 20:34560093-34560115 CTGGGTGCTGGCTGGTGGGATGG + Exonic
1172700384 20:36850051-36850073 CTAGGGGCTGACTCTTGGGTGGG - Intronic
1173381120 20:42543078-42543100 CTGGTTGCTGAATGTTGGAGTGG + Intronic
1173455245 20:43196436-43196458 CTGGCTGCTGTGTGTGGGGAGGG - Intergenic
1174650780 20:52123453-52123475 GTGGTTGCTGAATGTTGGGGTGG - Intronic
1176075062 20:63244625-63244647 CTGGCTGCTGCCTTTGGGGCAGG + Intronic
1176108018 20:63398718-63398740 CTGGCTCCTGGCTCCTGGGTGGG - Intergenic
1180229756 21:46420019-46420041 CTGGGTGCAGACACTTGGGTTGG + Intronic
1181002314 22:19993617-19993639 CTGGTTGCTGTGTTTTGGGTGGG - Intronic
1181174793 22:21029327-21029349 CTGGCTGCTGATGGGTGAGTGGG - Exonic
1181438345 22:22923085-22923107 CTGGGTTCTCAGTGTTGGGTGGG + Intergenic
1181750508 22:24985955-24985977 CTGTCTCCTGACTGCTGGGTTGG + Intronic
1181891485 22:26067395-26067417 CTGGCAGTTGATAGTTGGGTGGG - Intergenic
1181996742 22:26888791-26888813 CTGCTTGCTGGGTGTTGGGTGGG + Intergenic
1182106187 22:27691455-27691477 CTGGCTGCTGCCTGGAGGATGGG - Intergenic
1182434918 22:30324457-30324479 ATGGCTGCTGTCTGTAGGGCTGG - Intronic
1182820699 22:33213562-33213584 ATGGCTGCTGACTGACAGGTTGG - Intronic
1183621436 22:38975190-38975212 ATGGCTCCTCACTGTGGGGTTGG - Intronic
949765308 3:7519892-7519914 CTGGCTGCTGGCTGCTGGCTGGG + Intronic
950443228 3:13021981-13022003 CTGGCTGTCGACTGTTGGGCCGG - Intronic
951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG + Intronic
952634136 3:35506108-35506130 GAGGCTGCTGACTCTTGGATGGG - Intergenic
952651868 3:35737221-35737243 GGGGCTGCTGACTGGTGGGTGGG - Exonic
952754088 3:36850954-36850976 CTGGCTGCTGACTGTACTGTGGG - Intronic
952954386 3:38548266-38548288 CTGGCTGCAGACGGTGTGGTTGG - Exonic
953115529 3:39989171-39989193 GTGGCTGCTGACCTTTGGGTGGG + Intronic
953367386 3:42357478-42357500 ATGGCTGCTGACTGATCAGTTGG - Intergenic
953664113 3:44913857-44913879 CTGGCTGCTTATGGTTGTGTTGG - Exonic
955232616 3:57112462-57112484 CTGGATGCTGATTTATGGGTGGG - Intronic
956772659 3:72539545-72539567 CTCTCTGCTCACTGATGGGTGGG + Intergenic
957629980 3:82706560-82706582 GAGGCTGCTGACTCTTGGATTGG + Intergenic
961793566 3:129393737-129393759 CTGGCTGCTGAGTCTTGGGCTGG + Intergenic
962663471 3:137628921-137628943 GTGGCTGCTGACAGTTAGGGTGG + Intergenic
963605861 3:147411145-147411167 CTGGCCGCTGACTTTCGGTTTGG - Intronic
964326685 3:155554181-155554203 TTGGCAGTTGACTGTTGGGATGG - Exonic
965935339 3:174102669-174102691 CTGGCTGTTGACTGGTTGATTGG + Intronic
967544914 3:190714136-190714158 CTGGTTGCTGAAGGTTGGGGAGG + Intergenic
972448368 4:39169742-39169764 CTGGCTGCTGGCTATTGGCTGGG - Intergenic
975776543 4:77793673-77793695 CTGATTTCTGAGTGTTGGGTAGG + Intronic
977201720 4:94124075-94124097 GAGTCTGCTGACTGTTGGGCAGG + Intergenic
977401363 4:96536558-96536580 CTGGTTGCTGAAGGTTGGGGTGG - Intergenic
978018607 4:103780286-103780308 GTGGTTGCTGACAGTTGGGGTGG + Intergenic
979197731 4:117940955-117940977 GAGGCTGCTGACTCTTGGATGGG + Intergenic
979745470 4:124207063-124207085 CGGTCTGCTGACTGTTGCCTAGG + Intergenic
983821031 4:172193517-172193539 GAGGCTGCTGACCTTTGGGTGGG - Intronic
983963401 4:173781398-173781420 ATGGTTGCTGAAGGTTGGGTTGG - Intergenic
984237675 4:177180487-177180509 CTGGGTGGTGACTGTTGAGAAGG + Intergenic
985842396 5:2317920-2317942 CTGGCTGCTGTGGGTTTGGTGGG + Intergenic
987309686 5:16670496-16670518 CTGGCTGCCGTGTGTTGGGGTGG - Intronic
987544588 5:19296875-19296897 ATGGTTGCTGATGGTTGGGTTGG - Intergenic
989771255 5:45148870-45148892 CTAGCAGCTAACTGTTGAGTTGG + Intergenic
991587044 5:68212157-68212179 CTGCCTGCTAACTGATGTGTTGG - Intergenic
992240334 5:74762732-74762754 ATGGCTACTGACTCATGGGTGGG + Intronic
992557256 5:77915950-77915972 CTGCCTGCTGAGAGTTGGGGAGG + Intergenic
994757602 5:103814451-103814473 ATGGCTGCTGACTTTTGCCTGGG + Intergenic
995329621 5:110932945-110932967 CAGGTTGCTGACTTTTGGATGGG + Intergenic
995435605 5:112131606-112131628 TTGGCTGCTGACTATTGGCCAGG - Intergenic
995525737 5:113049353-113049375 CTGGCTGCTGCCAAGTGGGTGGG + Intronic
995560472 5:113375655-113375677 CTTGGTGCTGGCTGTTGGCTGGG + Intronic
996177834 5:120380604-120380626 ATGGTTGCTGAATGTTGGGGTGG + Intergenic
996592382 5:125161677-125161699 GAGGCTGTTGACTGTTGGATGGG - Intergenic
996829813 5:127727554-127727576 GAGGCTGCTGACTTTTGGATGGG - Intergenic
996873011 5:128212911-128212933 CTGTCAGCTGTCTGTGGGGTGGG + Intergenic
997067619 5:130580587-130580609 GAGGCTGCTGACTCTTGGATGGG - Intergenic
997405428 5:133642569-133642591 CTGGCATCTGAATGTTGGCTTGG - Intergenic
997856774 5:137379755-137379777 CTGGCTGGTGACTGGTGTGGTGG - Intronic
998250356 5:140548237-140548259 CTGGCTGGCGTCTGTTTGGTTGG + Intronic
1000549737 5:162645951-162645973 GTGGTTGCTGAATGTTGGGGTGG + Intergenic
1001057439 5:168461354-168461376 CTAACTGATGACTGTTGGGTTGG - Intronic
1001722179 5:173865913-173865935 ATGGCTGCTGTGTGTTGGGTGGG + Intergenic
1002439329 5:179256211-179256233 CTGGCGGCTTACTGTTCTGTGGG - Intronic
1002778969 6:352150-352172 CTGGCTGCTGCCTCCTGAGTGGG - Intergenic
1003158646 6:3617578-3617600 CTGTCTGCTGCTTGTAGGGTGGG + Intergenic
1003173901 6:3740796-3740818 CTGGCTCCTGCCTGTGGGTTCGG + Intronic
1004181724 6:13386450-13386472 CTGGCTGCTGGCTGCTGGCAGGG - Intronic
1004569140 6:16828132-16828154 GTGGTTGCTGAAGGTTGGGTAGG + Intergenic
1008471709 6:51891922-51891944 CTGGCTGCTGCCTGCTGGTCAGG - Intronic
1008621284 6:53273947-53273969 TTGGTTGCTGACTGTTGGGGAGG - Intronic
1009760897 6:68004019-68004041 CTGACTGCTGAATGTTGGCATGG - Intergenic
1010135372 6:72545783-72545805 GTGGCTGCTGAAGGTTGGGGTGG - Intergenic
1010156137 6:72795373-72795395 CTGACTGCTCCCTCTTGGGTTGG - Intronic
1010780779 6:79943972-79943994 ATGGGTGCTGTCTGTTGGTTGGG - Intronic
1012231673 6:96767686-96767708 GAGGCTGCTGACTTTTGGATGGG + Intergenic
1015314232 6:131799575-131799597 TTTGCTGTTTACTGTTGGGTAGG - Intergenic
1016579399 6:145612918-145612940 GTAGCTGCTGAATGTTGGGCTGG + Intronic
1018854167 6:167663512-167663534 CTGGTTGGTGGCTGGTGGGTGGG + Intergenic
1019205538 6:170358663-170358685 ATGGCTGCTGGCTGAAGGGTGGG + Intronic
1019472127 7:1226779-1226801 CTGACTGCTGCCTGGTGGGCTGG + Intergenic
1020091228 7:5342895-5342917 GTGGTTGCTGACAGTTGGGGTGG - Intronic
1022183085 7:27940626-27940648 CTGACTGCTGCATCTTGGGTGGG + Intronic
1026339994 7:69426878-69426900 CTGGCAGCTGAGTGTGGGTTGGG - Intergenic
1026590533 7:71691164-71691186 GTGGTTGCTGAATGTTGGGGCGG - Intronic
1028178162 7:87681681-87681703 CTGGCTGCTGAAGGATGGGGTGG + Intronic
1030212557 7:107010755-107010777 CAGGCTACTGACTTCTGGGTGGG + Intergenic
1032591182 7:133193818-133193840 GTGCCTGCTGACTGTTCTGTGGG + Intergenic
1032702947 7:134397952-134397974 CTGGCTGATGACTCTGGGGCTGG + Intergenic
1032734376 7:134677503-134677525 CTGGATGCTTACTGCTGGGGTGG - Intronic
1034201581 7:149285938-149285960 CTGGCTCCTGGCTGTGAGGTGGG + Intronic
1034844796 7:154434460-154434482 CTTGCTGCTGGCTTTGGGGTTGG + Intronic
1035386988 7:158479733-158479755 CTGGCTGCTGCCTGTGGGGGTGG + Intronic
1037264885 8:17047631-17047653 CTGGCTTCTGTCTGTTGCGATGG - Intronic
1039025278 8:33252177-33252199 GAGGCTGCTGACTTTTGGATGGG + Intergenic
1039293737 8:36127098-36127120 CAGGCTGCTGACCTTTGGATGGG + Intergenic
1039798956 8:40938031-40938053 TTGCCTGCTGGCTGTTGGCTGGG - Intergenic
1042071344 8:64938598-64938620 GTGTCTGTTGACAGTTGGGTTGG + Intergenic
1042098537 8:65246867-65246889 CTCGCTTCTGACTGGTGGGGAGG - Intergenic
1042664695 8:71192460-71192482 CTGTGTGCTGCCTGTTGGGCAGG - Intergenic
1043253549 8:78105749-78105771 GTGGCTGATGACTTTTGGATGGG + Intergenic
1043980526 8:86633299-86633321 CTTGATTCTGACTGTTGGCTGGG + Intronic
1045478242 8:102571511-102571533 CAGGTTTCTCACTGTTGGGTTGG + Intergenic
1047964866 8:130039084-130039106 CTGGCTGGTGAGCGTGGGGTAGG + Intergenic
1048319861 8:133390029-133390051 CTGCCTGCTGCCTGCTGTGTGGG - Intergenic
1048534119 8:135276574-135276596 ATTGCTGCTGAATGTTGGCTGGG - Intergenic
1049633680 8:143673971-143673993 CTGGATGGTGACTATTGTGTGGG + Intergenic
1050321391 9:4456308-4456330 ATGGTTGCTGAATGTTGGGGTGG + Intergenic
1050383655 9:5060253-5060275 GTGGCTGCTTAAGGTTGGGTTGG + Intronic
1051797731 9:20892884-20892906 GTGGCTGATGAATGTTGGGATGG - Intronic
1052418429 9:28208275-28208297 CTAACTGCTGCCTGTGGGGTGGG + Intronic
1054834136 9:69658731-69658753 ATAGGTGCTGGCTGTTGGGTGGG - Intronic
1055484742 9:76746208-76746230 ATGACTGATGACTGTTGGCTGGG + Intronic
1056227387 9:84509448-84509470 CTGGTTGCTGAAGGTTGGGGTGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056602018 9:88053921-88053943 CTTGCTGCAGACTGTGGGGCAGG - Intergenic
1060218533 9:121752557-121752579 CTGGGTGCTGAAGGTTGGGTAGG + Intronic
1060712420 9:125881381-125881403 CTGGCTGCTGACTCTAGGATAGG + Intronic
1061260969 9:129480968-129480990 CAGGGTGCTGCCTGTGGGGTGGG + Intergenic
1062053437 9:134458703-134458725 CTGCCTGCTGAGGGTTTGGTGGG + Intergenic
1062076895 9:134594523-134594545 CTGCCTGCACAGTGTTGGGTGGG - Intergenic
1062574982 9:137201846-137201868 CAGGCTGCTGACTGCAGGGCAGG - Intronic
1062732939 9:138119667-138119689 CTGGGTGCTGCCTGGTGGGTGGG + Intronic
1186740891 X:12517357-12517379 GAGGCTGCTGACTGTTGGATGGG + Intronic
1186913500 X:14194897-14194919 GTTGATGCTGACTGTTGGCTGGG - Intergenic
1186942202 X:14521959-14521981 GTGGTTGCTGAAGGTTGGGTTGG + Intergenic
1188860727 X:35252120-35252142 GAGGCTGCTGACTTTTGGATGGG - Intergenic
1189198430 X:39170990-39171012 CTGGCTTCTGACTGGTTGGATGG - Intergenic
1189348698 X:40261492-40261514 CTTGGTGCTGGCTGTTGGCTGGG + Intergenic
1189605781 X:42676356-42676378 CTGGCTGCTTATTGTTGGTAGGG + Intergenic
1189969811 X:46406635-46406657 CTTGCTACTGACTCTTGGCTGGG + Intergenic
1190326505 X:49210094-49210116 CTGCCCCCTCACTGTTGGGTGGG + Intronic
1190971909 X:55357465-55357487 GAGGCTGCTGACTTTTGGGTGGG - Intergenic
1191168666 X:57418875-57418897 CAGTCTGGGGACTGTTGGGTGGG - Intronic
1191640552 X:63426919-63426941 CTGGCTGCTTCCTGCTGGATAGG + Intergenic
1194021943 X:88702034-88702056 GAGGCTGCTGACTCTTGGATGGG + Intergenic
1194284377 X:91991205-91991227 TTGGCTGGTGTGTGTTGGGTGGG + Intronic
1195678032 X:107522416-107522438 AGTGCTGCTGACTGTAGGGTTGG + Intergenic
1197904443 X:131409963-131409985 CTGGCTGCTGTCTGGGGGATGGG - Intergenic
1199173263 X:144756787-144756809 GAGGCTGCTGACTTTTGGATAGG + Intergenic
1200013934 X:153144421-153144443 ATGGCTGCTGAGTGATCGGTGGG - Intergenic
1200025666 X:153255532-153255554 ATGGCTGCTGAGTGATCGGTGGG + Intergenic
1200601946 Y:5215764-5215786 TTGGCTGGTGTGTGTTGGGTGGG + Intronic