ID: 951036856

View in Genome Browser
Species Human (GRCh38)
Location 3:17942101-17942123
Sequence ATGTTTCAGCACAATTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951036856 Original CRISPR ATGTTTCAGCACAATTTATG AGG Intronic
900830810 1:4963852-4963874 ATGTAGCAGCACATTTTCTGGGG + Intergenic
908065125 1:60394762-60394784 ATTTTTCAGGAGAATTTATGTGG - Intergenic
909012598 1:70351817-70351839 ATGTATCAGAAAAATCTATGAGG + Intronic
909757791 1:79248656-79248678 TTGTTTCAACACAATTTGAGAGG + Intergenic
909785241 1:79604150-79604172 TTGTTTCAGAACAGCTTATGTGG + Intergenic
909974424 1:82028365-82028387 ATGTTTCATAAAAATTTAAGTGG + Intergenic
910413517 1:86972135-86972157 ATGTTTCAGAAAAATTTTTAAGG + Intronic
910894808 1:92057969-92057991 ATGTTTCAGCTCATCTTGTGAGG + Intronic
910898996 1:92099122-92099144 TTGTCTCAGCACCATTTATGGGG + Intronic
910989806 1:93043461-93043483 ATGTTTCAACTCAATTTAATAGG + Intergenic
913105658 1:115611996-115612018 ATGTGCCAACATAATTTATGAGG - Intergenic
913187025 1:116378079-116378101 AGATTTCAGCACAACTAATGAGG - Intronic
913268583 1:117069676-117069698 ATGTTTCAGAACTAATTAGGTGG + Intronic
913305433 1:117425333-117425355 ATTTTTCAGCTCATTCTATGAGG + Intronic
914371623 1:147030453-147030475 ATGTTTCAGCTCAAGTTCTGAGG + Intergenic
916426707 1:164687633-164687655 ATGTATCAGCCCAGCTTATGTGG + Intronic
916658571 1:166900002-166900024 AGGATTCAGCACAATTTAGGTGG - Intergenic
917122697 1:171658402-171658424 TTGTTTCAAAACAGTTTATGTGG - Intergenic
921928575 1:220733812-220733834 AAGTTTCAGTAAAAATTATGGGG + Intergenic
922683514 1:227620347-227620369 CTTTTTCAGCACAATGTAAGTGG - Intronic
924284159 1:242468587-242468609 ATGTTTCAGAACAATGTGTATGG - Intronic
1066222615 10:33350422-33350444 ATGTTTCAGGAAAATTTTTCAGG + Intergenic
1066636180 10:37503950-37503972 ATGTTCCAGAACAATTATTGAGG - Intergenic
1071427165 10:85570842-85570864 ATTTTTCAGCAAACTTTAGGAGG - Intergenic
1071864557 10:89712988-89713010 GTGTTTTAACAAAATTTATGGGG + Intronic
1073215902 10:101836078-101836100 GTGTCTCAGCCCAATTTGTGGGG + Intronic
1074378545 10:112959505-112959527 TTGTTGCAGCAGAATTTCTGAGG + Intronic
1074712017 10:116185368-116185390 ATGTAGCATCACAATTAATGTGG - Intronic
1075692553 10:124408151-124408173 ATGTTTCATAAAAATTTATGAGG - Intronic
1077886073 11:6389299-6389321 ATTTTTCAGCAGAATTTCAGAGG - Intergenic
1078367621 11:10719847-10719869 ATGTTGCAGCAGGATTTGTGAGG - Intergenic
1080316151 11:30951186-30951208 CAGTTTCAGCACAATATATCTGG - Intronic
1081136574 11:39446942-39446964 ATGTATCAGCAAAATTTAAATGG + Intergenic
1085922807 11:80979174-80979196 ATGTTTCAGCCAAATATCTGTGG - Intergenic
1086103040 11:83121478-83121500 ATGTTACAGTGCATTTTATGTGG + Intergenic
1086814131 11:91347374-91347396 AAGTTTCAGCAAAATTTGTTTGG - Intergenic
1086941316 11:92801227-92801249 CTGGTTCAGCACAGTTAATGGGG + Exonic
1087138397 11:94742374-94742396 ATGTTTATGTACAATTTAAGAGG - Intronic
1087437239 11:98136725-98136747 ATTTTTCAACAAAATTTCTGGGG + Intergenic
1087639005 11:100735329-100735351 ATGTTTCTGAACTATTTAAGAGG + Intronic
1088697674 11:112382518-112382540 TTGTTCCAGCACCATTTGTGTGG + Intergenic
1089908958 11:122076239-122076261 ATTTTTCAACACAATTTGTCTGG - Intergenic
1090674855 11:128982386-128982408 TTGTTTAATCACAATATATGTGG - Intronic
1090715277 11:129424830-129424852 ATGATTGAGCACAAGCTATGAGG + Intronic
1091279804 11:134375357-134375379 ACGTTTCAGCACTTTTTCTGAGG - Exonic
1091964230 12:4724362-4724384 AAGTTTCAGTATAAGTTATGGGG + Intronic
1093113325 12:15179600-15179622 ATGTTTCCTAACAATTTTTGGGG - Intronic
1095545609 12:43364299-43364321 AGTTTTCAACAAAATTTATGAGG + Intronic
1097776834 12:63657072-63657094 AACTTTCAGCAAAAATTATGAGG - Intronic
1099602144 12:84754057-84754079 AAGTTTTAAAACAATTTATGCGG - Intergenic
1101455065 12:104823541-104823563 TTGTTACAGCACCATTTATTGGG - Intronic
1102089714 12:110175466-110175488 ATGTTTCCTCTCAATTTATATGG - Intronic
1103822429 12:123709834-123709856 ATGAAACAGCACATTTTATGTGG - Intergenic
1105244206 13:18633579-18633601 ATGTTTCACCTCCAATTATGTGG - Intergenic
1105384557 13:19917665-19917687 ATTTTTCAGCAGGATTAATGTGG + Intergenic
1106297740 13:28433127-28433149 GTGTGTCAGCATGATTTATGCGG - Intronic
1108635005 13:52324437-52324459 ATGTTTCAGTACATTTTACATGG - Intergenic
1108652799 13:52498751-52498773 ATGTTTCAGTACATTTTACATGG + Intergenic
1108739869 13:53325449-53325471 ATGTTTCTCCAGATTTTATGTGG - Intergenic
1109705709 13:66089312-66089334 ATATTTCAACAAAATTTATCTGG - Intergenic
1110909821 13:80943582-80943604 ATGTTTTAGCAAAAAGTATGAGG + Intergenic
1112130334 13:96516539-96516561 ATATTTCAACAAAATATATGAGG - Intronic
1112221288 13:97493762-97493784 TAGTTTCAGTAGAATTTATGAGG - Intergenic
1112643218 13:101300642-101300664 ATGTTACAGCACAGTCTATCAGG - Intronic
1114142448 14:19929694-19929716 ATGGTTCTGCTCATTTTATGAGG - Intergenic
1115184609 14:30671550-30671572 ATGTTTAAGAACAATTTAAGAGG + Intronic
1115754026 14:36516184-36516206 TTGTTTCCACACAATTTCTGAGG + Intergenic
1115793392 14:36905212-36905234 ATGCTTCAGCAAAAGCTATGTGG + Intronic
1116098295 14:40401559-40401581 ATGTTTCAGAACATGTTTTGGGG + Intergenic
1116611337 14:47076482-47076504 ATGTTCCATCACATTTTATCAGG + Intronic
1116953980 14:50904709-50904731 AGGTTTCAGCATAATTTGGGGGG - Exonic
1120534234 14:85673073-85673095 ATGTTTCAGCAAAATATTTAAGG - Intergenic
1122377371 14:101272320-101272342 ATTTCTCAGCTCATTTTATGAGG - Intergenic
1123167670 14:106342177-106342199 ATAATTGACCACAATTTATGAGG + Intergenic
1123170293 14:106366888-106366910 ATAATTGACCACAATTTATGAGG + Intergenic
1124449717 15:29775939-29775961 ATGTTTTGGCACAATTTCTCTGG - Intronic
1127107358 15:55630785-55630807 TTGTTTCAGCACTATGTTTGTGG + Intronic
1132395467 15:101470430-101470452 ATCTTACAGCACAGTGTATGGGG - Intronic
1133540511 16:6748357-6748379 ATGTATGAGCACAAATTATTTGG + Intronic
1135115799 16:19722549-19722571 ATGCTTAAGAACAATTTATTCGG - Intronic
1135988821 16:27204468-27204490 TTGTTTTTGCACAATTTTTGTGG + Intronic
1137054709 16:35738849-35738871 ATCTTTCAGTACTATTTATGGGG + Intergenic
1139208781 16:65055686-65055708 TTGTTTCAGCATAAATTCTGAGG - Intronic
1140803823 16:78514092-78514114 ATGCTTGAGCAGTATTTATGGGG - Intronic
1141402821 16:83765406-83765428 ATTTTTCAGCCCAAATTATGTGG + Intronic
1144026554 17:11281653-11281675 ATTTTTCGGCATATTTTATGAGG - Intronic
1145820652 17:27831889-27831911 TTGTTTCAAAGCAATTTATGTGG + Intronic
1145821288 17:27837932-27837954 TTGTTTCAAAGCAATTTATGTGG - Intronic
1146360209 17:32168659-32168681 ATGCATCAGAATAATTTATGAGG - Intronic
1148571523 17:48673474-48673496 ATGTCCCAGCACTATTTGTGGGG - Intergenic
1148913542 17:50956116-50956138 AAGTTTCAGAAGAATTTCTGCGG - Intergenic
1150559863 17:66285181-66285203 ATGTTAAAGCATATTTTATGTGG + Intergenic
1150821679 17:68439668-68439690 ATGTTTCAGGAATATTTATCTGG + Intronic
1153677014 18:7464847-7464869 ATGTTTCAAGAAACTTTATGAGG - Intergenic
1154444735 18:14426322-14426344 ATGTTTCACCTCCAATTATGTGG + Intergenic
1158286925 18:55893906-55893928 ATGTTAAAGCAAAATTTATCAGG - Intergenic
1159290331 18:66409997-66410019 ATGTTTCAGCACTATGTTTAGGG + Intergenic
1159651498 18:70984038-70984060 GTGTATCAGCCCACTTTATGTGG + Intergenic
1164373408 19:27661391-27661413 CTGTTTTTGCACAATCTATGAGG - Intergenic
1165593680 19:36992523-36992545 ATGTTTCAGCTCCATTTACTAGG + Intronic
1166610445 19:44188908-44188930 TTGTTTCAAAACAACTTATGTGG - Intergenic
925327379 2:3033975-3033997 ATGGTTTAGTATAATTTATGGGG + Intergenic
926590089 2:14731494-14731516 CTGCTTCAGAACAATTTTTGTGG + Intergenic
928845015 2:35661188-35661210 AGGTTTAAGCCCAATTTATTAGG - Intergenic
929972599 2:46595912-46595934 ATGTTTCAATAAGATTTATGTGG + Intronic
931658987 2:64539433-64539455 ATGTTGCAGCACAAATGATTGGG + Intronic
931794391 2:65695461-65695483 ATGTTTGAGCCCAATTTTTAAGG - Intergenic
935759374 2:106305141-106305163 ATGCTTCAGCAGAATTGCTGAGG + Intergenic
935928523 2:108097234-108097256 ATGTTTTAGAAGACTTTATGTGG + Intergenic
937632465 2:124118854-124118876 ATGATTCTGGACAAATTATGTGG - Intronic
938170680 2:129073075-129073097 ATGTTTGACCACAATTAATCAGG - Intergenic
941942410 2:171055481-171055503 ATTTTTCAGAATAATTTATTTGG - Intronic
942300032 2:174552250-174552272 ATGTTTAAGCACACTTTGGGAGG - Intergenic
943846390 2:192654823-192654845 ATGTTACAGCACAATGTTGGTGG + Intergenic
944218680 2:197280551-197280573 ATCTGTCAGGACAAATTATGTGG + Intronic
945675550 2:212851501-212851523 AAGTTTGAGAACAATCTATGAGG + Intergenic
947843591 2:233225941-233225963 ATGATTCAGCACAACTTCAGAGG - Intronic
1170435955 20:16328920-16328942 AAATTTCAACACAATTTAGGAGG + Intronic
1171094215 20:22315970-22315992 ATGGCTCAGCACCATTTCTGTGG - Intergenic
1174318408 20:49720910-49720932 ATGATGCTGCACAATTTGTGAGG + Intergenic
1174725298 20:52855271-52855293 AAGTTTTAAAACAATTTATGGGG - Intergenic
1176451252 21:6863542-6863564 ATGTTTCACCTCCAATTATGTGG - Intergenic
1176829421 21:13728593-13728615 ATGTTTCACCTCCAATTATGTGG - Intergenic
1177946096 21:27471414-27471436 GTGTTTCAGCACCCTTTATATGG - Intergenic
1179350713 21:40608143-40608165 ATACTTCAGCAGAATTCATGAGG - Intronic
1179388666 21:40967259-40967281 ATGTTTCAGCCCTGTTTATGAGG - Intergenic
949453205 3:4210534-4210556 ATGATCCAGCACCATTTATGGGG - Intronic
949570819 3:5291316-5291338 ATGTGTCAGCACAATTTAAAAGG - Intergenic
950397496 3:12744816-12744838 ATGTTTAAACACAATTAATTTGG - Intronic
951036856 3:17942101-17942123 ATGTTTCAGCACAATTTATGAGG + Intronic
951999403 3:28768473-28768495 AAGTTTCAGCATAATTTTGGAGG + Intergenic
952506046 3:34007649-34007671 ATGTAACAGAAGAATTTATGGGG - Intergenic
954983800 3:54771361-54771383 AAGTCTCAGCACAAGTTAGGTGG + Intronic
955101292 3:55852603-55852625 ATCTTGCAGCAGAATTAATGAGG + Intronic
955746361 3:62144373-62144395 ATGTTTCAACTGAATTAATGAGG + Intronic
955864652 3:63370527-63370549 AAGTTTCAGCATAATTTTTTGGG - Intronic
956673698 3:71715317-71715339 ATGTTTTAGCACACCTTCTGTGG + Intronic
959770493 3:110089763-110089785 ATGTTTCAGGAGAATATAGGTGG - Intergenic
960478984 3:118164709-118164731 TTATTTCAACACATTTTATGAGG + Intergenic
960533373 3:118790016-118790038 ATGTTTCTTCACATTTAATGAGG - Intergenic
963981712 3:151545512-151545534 ATGGTTTAGCCCAATTTCTGTGG + Intergenic
964248123 3:154678231-154678253 ATGTGTCAGCATGATGTATGTGG - Intergenic
966212198 3:177464882-177464904 ATGTTTCAGGAGAATGGATGTGG + Intergenic
966456297 3:180119854-180119876 ATTTTCCAACACATTTTATGAGG - Intergenic
966938366 3:184729507-184729529 TTCTTTCAGCAAAATTTATGGGG - Intergenic
969829939 4:9787168-9787190 ATGTATCAGAACAAGTTCTGGGG - Intronic
972932034 4:44083635-44083657 ATGTTTCACCACAATTGATGGGG - Intergenic
973267227 4:48222680-48222702 ATGTTTCAGCCCAAGTAGTGAGG - Intronic
975981715 4:80168817-80168839 TTGTCCCAGCACAATTTGTGGGG + Intergenic
977414007 4:96706365-96706387 ATGTTTAAAAACAATTTTTGAGG - Intergenic
977719789 4:100225550-100225572 ATGTTTTAGCAAAAATCATGTGG + Intergenic
978959211 4:114655376-114655398 TTGTTTCAAAACAACTTATGTGG - Intronic
979769850 4:124509398-124509420 ATTTTCCAACACAATCTATGAGG + Intergenic
980567613 4:134564407-134564429 ATGTTTTAGCACACCATATGAGG + Intergenic
980802824 4:137774734-137774756 AATTTTCAGCACAATTTAAGAGG + Intergenic
981909413 4:149961436-149961458 ATGTTTCAGTTCATTTTATGGGG - Intergenic
984682647 4:182627817-182627839 ATGTTTAAGCAGAAATTGTGTGG - Intronic
986902868 5:12458666-12458688 ATGTTTCAGCTGACCTTATGGGG + Intergenic
988733754 5:34000167-34000189 ATGAGTCAGCACAAATTAAGAGG - Intronic
992501104 5:77345024-77345046 ATGTATCAGCACATTTTCTTAGG + Intronic
994055617 5:95410869-95410891 ATGTCTCAGAACTATTTATTTGG - Intronic
994286307 5:97972440-97972462 ATGATTCAGGATAATTTATCTGG - Intergenic
1001178715 5:169497936-169497958 TGGTTAGAGCACAATTTATGTGG - Intergenic
1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG + Intergenic
1003632105 6:7796316-7796338 ATGTTTTGGCAGATTTTATGAGG + Intronic
1007921431 6:45613543-45613565 TTGTTCCAGCAACATTTATGGGG + Intronic
1008150212 6:47941019-47941041 TTGTTTCAGAACAATTGATATGG - Intronic
1008554982 6:52665306-52665328 CTGTTTCACCACAATTGAAGAGG + Intergenic
1008771774 6:54987562-54987584 ATGTTTCAGAACAATTAAATAGG + Intergenic
1008862738 6:56169496-56169518 AGGTGTAAGCCCAATTTATGAGG - Intronic
1009588824 6:65639560-65639582 ATATTTCAGCACACTTTTAGCGG + Intronic
1010940091 6:81906589-81906611 ATCCTTCAGCATAGTTTATGGGG + Intergenic
1011260383 6:85464494-85464516 TTGTTTCCTCACACTTTATGGGG + Intronic
1013087084 6:106866009-106866031 ATTTTTCAGCAAAATTTCAGAGG - Intergenic
1013731042 6:113167952-113167974 GTGTTTGAGCACATTTAATGTGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014487586 6:122018944-122018966 ATGTTTTAGCCAACTTTATGTGG - Intergenic
1021909619 7:25371256-25371278 ATGTATCTGCACATTTTCTGTGG + Intergenic
1022361585 7:29664703-29664725 AACTTTCAGCAAAAATTATGAGG + Intergenic
1022699802 7:32749019-32749041 AACTTTCAGCAAAAATTATGAGG - Intergenic
1022935754 7:35174731-35174753 AACTTTCAGCAAAAATTATGAGG - Intergenic
1025224403 7:57144222-57144244 TTCTCTCAGCACAATTTCTGAGG - Intergenic
1027926835 7:84475849-84475871 ATGTTTCAGCATTATTTTTTTGG + Intronic
1028031852 7:85925777-85925799 ATGTTTCAGTACACTTGATGAGG - Intergenic
1028227966 7:88271825-88271847 ATGTTTGAGCACACATTCTGTGG - Intergenic
1028607461 7:92670708-92670730 ATGTTTCAGTAGCATTTATAGGG - Intronic
1028862374 7:95667348-95667370 ATGTTGCAGAATAATTTCTGAGG - Intergenic
1028992882 7:97068675-97068697 AAGTTTCAGAACAATGTATATGG - Intergenic
1030458665 7:109804344-109804366 AAGTTTAACCACAAGTTATGAGG - Intergenic
1030675114 7:112376337-112376359 ATGTTTCTGGAGTATTTATGTGG - Intergenic
1031134150 7:117867649-117867671 ATGTTTCAGCCCACTCTAGGGGG + Intronic
1036010354 8:4714738-4714760 TTATTTCAGCAAAATTTAAGTGG - Intronic
1036515001 8:9435749-9435771 ATGTTTCAGGAAAATTTCAGGGG - Intergenic
1036950493 8:13134647-13134669 TTGTTTTATCAAAATTTATGAGG - Intronic
1038429613 8:27489831-27489853 ATGTTTCAGAACACTTTTTGTGG - Intergenic
1039585895 8:38706681-38706703 ATTTTTCAGCAAAACTTTTGAGG - Intergenic
1039973731 8:42342341-42342363 ATGTTGCAGCATAATTTGTCAGG + Intronic
1041037027 8:53802892-53802914 AGGTTTAAGCACAATTTCTAAGG - Intronic
1041060989 8:54034360-54034382 AATTTTCAGCAAAAATTATGAGG - Intergenic
1041519575 8:58740550-58740572 GAGTTTCAGCAGAGTTTATGAGG + Intergenic
1048057260 8:130879510-130879532 AAGTGTAAGCACAATTTTTGAGG + Intronic
1048755188 8:137730706-137730728 ATGTTTCAACACAACATTTGAGG - Intergenic
1048877438 8:138847954-138847976 ATGTCTAAGGACAATTAATGAGG + Intronic
1052028370 9:23600496-23600518 CTTTTTGTGCACAATTTATGAGG - Intergenic
1056588265 9:87943326-87943348 ATGTTTAAGTACAATTTATAAGG - Intergenic
1059058243 9:111006941-111006963 ATGTTCCAGAACCATTCATGAGG - Intronic
1203517929 Un_GL000213v1:20975-20997 ATGTTTCACCTCCAATTATGTGG + Intergenic
1186668441 X:11743767-11743789 ATCTTTCAGCACAATTTCTCTGG + Intergenic
1188240744 X:27785985-27786007 ATGTATTATCACAATTAATGTGG - Intergenic
1191669175 X:63733227-63733249 AGGTGGCAGAACAATTTATGGGG + Intronic
1192446245 X:71213710-71213732 ATTTTTCACAACAATTTATTGGG + Intergenic
1192748651 X:73965066-73965088 AGGTTTCAGCAAAAAGTATGAGG - Intergenic
1194673317 X:96763417-96763439 ATGTTTTACCTCAATTTATCAGG + Intronic
1194874859 X:99174515-99174537 ATTTTGCAGAACTATTTATGTGG - Intergenic
1195201315 X:102552742-102552764 ATATTTAAGCCAAATTTATGTGG - Intergenic
1195485664 X:105403011-105403033 ATGTTGCAGCACACTTTAATTGG - Intronic
1197440882 X:126488168-126488190 ATGTGTCAGTACATTTTATTGGG - Intergenic
1199064509 X:143399108-143399130 ATGTATCAGGACATTTTATGAGG + Intergenic
1201849893 Y:18467513-18467535 ATATTACAGAACAATCTATGGGG - Intergenic
1201883425 Y:18852862-18852884 ATATTACAGAACAATCTATGGGG + Intergenic
1202268061 Y:23041722-23041744 ATGTGTCACAATAATTTATGTGG - Intergenic
1202421053 Y:24675466-24675488 ATGTGTCACAATAATTTATGTGG - Intergenic
1202449733 Y:24994616-24994638 ATGTGTCACAATAATTTATGTGG + Intergenic