ID: 951045742

View in Genome Browser
Species Human (GRCh38)
Location 3:18036277-18036299
Sequence CTGTGTTAGGACATGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951045742 Original CRISPR CTGTGTTAGGACATGGCTCT TGG Intronic
900185657 1:1331992-1332014 CTGTGTCAGGAGATGCCTCTTGG + Intronic
900245969 1:1636192-1636214 CTGTGTTGGGACGGGGCTCAGGG + Intronic
900257194 1:1703335-1703357 CTGTGTTGGGACGGGGCTCAGGG + Intronic
903103983 1:21058468-21058490 CAGAGTGTGGACATGGCTCTAGG + Intronic
903857648 1:26346186-26346208 CTGGGTGGGGACTTGGCTCTCGG + Exonic
903994138 1:27294788-27294810 CTGAGCTAGGACATCTCTCTGGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
910467773 1:87518383-87518405 CTATGATATGTCATGGCTCTGGG + Intergenic
913303265 1:117396165-117396187 ATGGCTTAGGACAAGGCTCTGGG - Intronic
920648025 1:207817505-207817527 CTGGGTTAGTATGTGGCTCTGGG + Intergenic
923015839 1:230126226-230126248 CTGTGCTAGGAGAGGGCTGTAGG + Intronic
1067166527 10:43870018-43870040 CTCTGTAAGGACAAGGCCCTTGG + Intergenic
1067458121 10:46438062-46438084 TTTTGTTAGGACCTGGCCCTGGG - Intergenic
1067629075 10:47946572-47946594 TTTTGTTAGGACCTGGCCCTGGG + Intergenic
1069965133 10:72108999-72109021 CTGTGTTTGGAGATGACTCTAGG - Intronic
1072078947 10:92008880-92008902 CTGTGTGATGACATGGGTTTAGG + Exonic
1072251257 10:93584015-93584037 CTGAGTAAGGATATCGCTCTAGG - Intronic
1072869750 10:99104755-99104777 CTTTGTAAGGACATGGCTGAAGG + Intronic
1073114502 10:101083706-101083728 CAGTGTCAGGACCTGGCTCCAGG - Intergenic
1073249490 10:102113176-102113198 CATTGTGAGGACAGGGCTCTGGG - Intronic
1073344278 10:102770564-102770586 CCTTCCTAGGACATGGCTCTTGG - Intronic
1074298096 10:112209625-112209647 CTCTGCTAGGACTTGGCTATGGG - Intronic
1075649224 10:124116850-124116872 CAGTGTGAAGACATGGCTGTGGG + Intergenic
1076288300 10:129322955-129322977 CTGTGTCAGATTATGGCTCTTGG - Intergenic
1076946997 10:133658320-133658342 CTGTGTCAGCACAGGGCTCTGGG - Intergenic
1077013972 11:391946-391968 CTGTGTCAGGAGCTGGCTCCAGG + Intergenic
1078597284 11:12698316-12698338 ATGTGTTAGGACAAGGCTAGGGG + Intronic
1078718244 11:13859853-13859875 CTTTGTTAGGCCAGGCCTCTTGG + Intergenic
1078800713 11:14642533-14642555 CTGTTTTAGGTCATGACTGTGGG + Intronic
1079265842 11:18932104-18932126 CTGTAGTAGGACATGGCTGTTGG - Intergenic
1079491233 11:20991121-20991143 TTGTGATGGCACATGGCTCTAGG - Intronic
1080327961 11:31100059-31100081 CTGTGCTAGGATATGGCACAAGG + Intronic
1080590880 11:33722346-33722368 CAGTCTCAGGACATGGATCTAGG - Intronic
1080671032 11:34377999-34378021 GAGTGTTAAGTCATGGCTCTAGG - Intergenic
1080925712 11:36753954-36753976 CTGTGTGAGCACCTAGCTCTGGG - Intergenic
1081513152 11:43796424-43796446 CTGTATTAGTACATGATTCTGGG + Intronic
1085064537 11:73481951-73481973 CTGTGTCCTCACATGGCTCTAGG - Intronic
1089292673 11:117447672-117447694 CTGTGTATGGCCTTGGCTCTAGG - Intronic
1089776230 11:120838201-120838223 CTGAGTCAGGACTTGACTCTGGG - Intronic
1090309124 11:125719349-125719371 CTGCCCTAGGACATTGCTCTAGG - Intergenic
1091477603 12:791850-791872 CTGGGTTAATACATGACTCTTGG - Intronic
1091997284 12:5003454-5003476 CTATGTGTGGGCATGGCTCTAGG + Intergenic
1092049120 12:5455469-5455491 CTCTGTTAGGACAGGACTCCTGG - Intronic
1094258586 12:28464895-28464917 CAGTTCTAGGACTTGGCTCTTGG + Intronic
1096195020 12:49644220-49644242 CTGTGTGAGGCCATGGCTCCTGG + Exonic
1097425957 12:59445423-59445445 CTATGTTAGCTCATGGCCCTAGG + Intergenic
1098890988 12:76010619-76010641 GTGGGTTCAGACATGGCTCTGGG + Intergenic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1103913827 12:124365865-124365887 CTGTGTTTGGACCTGGGTCAGGG - Intronic
1106896080 13:34303352-34303374 CTGTGTTTGCTCAAGGCTCTGGG - Intergenic
1107778857 13:43877988-43878010 AAGTGTTAGGACATGACACTAGG + Intronic
1107953627 13:45487309-45487331 ATGTTTTAGGACATTGGTCTAGG + Intronic
1110335474 13:74325282-74325304 CCATGTTAGGAGATGGTTCTTGG - Intergenic
1113264852 13:108606392-108606414 CAGTCTCAGGACATGGCACTAGG + Intronic
1114270356 14:21097358-21097380 TTGCGTTAGGACATGCCTCTGGG - Intronic
1114339021 14:21723754-21723776 CTGTGTCAGCACAGGGCTTTTGG - Intergenic
1114432218 14:22671281-22671303 CAGTTCTAGGACTTGGCTCTTGG + Intergenic
1115629194 14:35226871-35226893 GTGTGTTAGTGCATGTCTCTAGG - Intronic
1118724542 14:68619731-68619753 CTTTCTTAGGACAGGGATCTGGG - Intronic
1120218066 14:81702300-81702322 CTTTCTTATGACATGGGTCTTGG - Intergenic
1121938633 14:98045165-98045187 CTCTCTGAGGACATGGCACTTGG - Intergenic
1122379592 14:101292866-101292888 ATGTGTTAGAACATGGCCCTGGG - Intergenic
1122914754 14:104853609-104853631 CTGGGTGAGGACATGATTCTTGG - Intergenic
1123199666 14:106650578-106650600 CTGTTTTTGGACATGGATCTGGG + Intergenic
1202921063 14_KI270723v1_random:30869-30891 CTGTGTCAGCACAGGGCTCTCGG - Intergenic
1202923849 14_KI270724v1_random:6705-6727 CTGTGTCAGCACAGGGCTCTGGG + Intergenic
1123797620 15:23788287-23788309 CTGTATAAGCACATTGCTCTTGG + Intergenic
1127122030 15:55780107-55780129 AGGGGTTAGGAGATGGCTCTAGG + Intergenic
1130561674 15:84963838-84963860 CTGTGCTAGGAAATGGCTAGAGG - Intergenic
1130801023 15:87263298-87263320 CTATGTTAGGAACTGACTCTAGG - Intergenic
1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG + Intergenic
1138586847 16:57976160-57976182 CTGTGTTAGGCAAGGACTCTAGG - Intergenic
1141002695 16:80323329-80323351 ATGTGATAGGAGGTGGCTCTGGG - Intergenic
1141160740 16:81627839-81627861 CTGTGTTGGGAGCTGGCGCTGGG + Intronic
1141630195 16:85283479-85283501 CTGAGTTAGGCCATGCCTCAGGG - Intergenic
1142202537 16:88768075-88768097 CTGTGGTGGCACATGGCTTTGGG - Intronic
1142227040 16:88882554-88882576 CTGTGTGTGGGCATGGCTGTGGG + Intronic
1144016122 17:11198224-11198246 ATGTGTTTGGAAAGGGCTCTGGG + Intergenic
1148743205 17:49904431-49904453 CTGTGTTCTGACATCCCTCTTGG - Intergenic
1149102498 17:52922892-52922914 CTGGCTTAGGACTTGGCTCAGGG - Intergenic
1151493479 17:74446077-74446099 CTGGCGGAGGACATGGCTCTGGG - Intronic
1203170901 17_GL000205v2_random:147279-147301 CTGTGTTAGCAAGGGGCTCTGGG - Intergenic
1154303259 18:13213203-13213225 CCGTGGGAGGCCATGGCTCTGGG + Intergenic
1158470954 18:57736394-57736416 ATGTTTTAGGACATTGGTCTAGG - Intronic
1160829744 19:1098209-1098231 CTGTGTTGGGAAATGACTGTTGG + Intergenic
1161053838 19:2180083-2180105 CTGTGTTAGGCCAAGGACCTTGG + Intronic
1162984647 19:14261762-14261784 CTTTCTCAGGACAGGGCTCTGGG + Intergenic
1163537892 19:17888217-17888239 CTGTGCTAGGCCATGGCAGTTGG + Intronic
1165758464 19:38307541-38307563 CTGTGTGAGGACAAGGCCCAAGG + Intronic
925044784 2:764587-764609 CTGTGTTAGAAAATGGCTCCAGG - Intergenic
925538283 2:4939500-4939522 CTGTTTTAGGGCATGTGTCTGGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930091906 2:47536968-47536990 CTGTGTTTGGACATGATTATGGG + Intronic
930161413 2:48161085-48161107 ACGTGTTAGGACATTGGTCTAGG + Intergenic
933795388 2:85915356-85915378 CTCTGCTAGAGCATGGCTCTTGG - Intergenic
934773273 2:96921445-96921467 CTGTATGAGGACCAGGCTCTGGG + Intronic
937563243 2:123251053-123251075 GAGAGTTAGGACCTGGCTCTTGG + Intergenic
938619282 2:133032176-133032198 CAGTTTTAGGACTTGACTCTTGG + Intronic
940117505 2:150225257-150225279 CTGTGTTAGGACATACATGTTGG - Intergenic
943062627 2:183054312-183054334 CTATGTTAGTACATGGCTTCAGG + Intergenic
946698151 2:222383024-222383046 TTGTATTAGGGCATGGCTCAAGG - Intergenic
947398295 2:229708018-229708040 CTGGGTTAGAATCTGGCTCTGGG - Intronic
948662116 2:239514128-239514150 CTGTGTTGGGGGATGGCCCTCGG - Intergenic
1173256083 20:41395128-41395150 CTGGGTTCAGACATGGCTCCAGG + Intergenic
1174306601 20:49617837-49617859 CTGTGTCACCAAATGGCTCTTGG + Intergenic
1174358624 20:50014547-50014569 CTGTGTTGGCACAGGGGTCTGGG + Intergenic
1175520684 20:59600753-59600775 CTGAGTCAGGAAATGGCTTTGGG + Intronic
1175815737 20:61882375-61882397 CTGTGGTGGGACCTGTCTCTGGG - Intronic
1176326886 21:5509110-5509132 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176330818 21:5547101-5547123 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176396939 21:6273850-6273872 CTGTGTCAGCAAATGGCTCTGGG - Intergenic
1176400871 21:6311841-6311863 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1176436286 21:6677263-6677285 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176440218 21:6715254-6715276 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176460548 21:7004333-7004355 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176464480 21:7042323-7042345 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1176484109 21:7386111-7386133 CTGTGTTAGCAAAGGGCTCTGGG - Intergenic
1176488041 21:7424102-7424124 CTGTGTCAGCAAATGGCTCTGGG + Intergenic
1178402464 21:32298646-32298668 CTGTGTGAGGACAGGGAGCTGGG - Intronic
1179470214 21:41605390-41605412 CTGGGTTAGAACCTGGCTCCAGG + Intergenic
1180925248 22:19549298-19549320 CTGTGTTTGGAGGTGGCTGTGGG - Intergenic
1183955304 22:41376670-41376692 GTGTGTGAGGACAAGGCTGTGGG - Intronic
1184314860 22:43678410-43678432 CTCTATCAGGACATGGCTTTGGG + Intronic
1184695651 22:46137491-46137513 CTGGGGTAGGGCCTGGCTCTTGG - Intergenic
951045742 3:18036277-18036299 CTGTGTTAGGACATGGCTCTTGG + Intronic
952739127 3:36718304-36718326 CTGTGTTTGGAAGTGGCTCTTGG - Intronic
957080465 3:75632096-75632118 CTGTGTCAGCACAGGGCTCTGGG + Intergenic
957136009 3:76290061-76290083 CTGAATTTGGACATGGCTTTGGG + Intronic
959205861 3:103305461-103305483 CTAAGTTAGAACGTGGCTCTTGG + Intergenic
961244131 3:125436743-125436765 CAGTGTGAGGACAGGGCACTGGG + Intergenic
961513914 3:127421064-127421086 CTGTGTGAGCCCAGGGCTCTTGG - Intergenic
962078713 3:132114462-132114484 CAGTTTTAGGACTTGGCTCTTGG - Intronic
963283975 3:143415055-143415077 CTGGGTTAGGCCTTGGCTCAAGG - Intronic
967810939 3:193760564-193760586 CTGTGGTAGGAAATGGCCTTTGG - Intergenic
969853371 4:9979678-9979700 CAGTGTTAGAAGGTGGCTCTGGG - Intronic
971757016 4:30719277-30719299 CTTGGTTAGGACATGGTTATCGG - Intergenic
973015418 4:45131232-45131254 CTTTGTGAGCACATGGCTATTGG + Intergenic
975694489 4:76998345-76998367 CTGTATTAGGAAATTGCTTTTGG + Intronic
979414459 4:120418828-120418850 GTGTGTAAGAACATGGCTTTTGG + Intergenic
981455539 4:144949033-144949055 CAGTGTTAGGACATCACTGTTGG + Intergenic
985450455 4:190059119-190059141 CTGTGTCAGCACAGGGCTCTGGG - Intergenic
985848364 5:2370900-2370922 GTGTGGGAGGACAAGGCTCTTGG + Intergenic
986445140 5:7814951-7814973 CTGGGCTAGGACATGGGTCGGGG - Intronic
986997263 5:13621290-13621312 CAGTGTGAGGTCATGGCTCTTGG - Intergenic
989802300 5:45558233-45558255 CTGGGTTAGGATTTGGCTCAGGG - Intronic
992531140 5:77652876-77652898 CTGGGTTAGAACAGGGCTCCAGG - Intergenic
993121538 5:83780307-83780329 GTGTGTTATGACATGTTTCTGGG + Intergenic
995341337 5:111064108-111064130 CTGTGTAAGCACATTGCCCTGGG + Intergenic
998256298 5:140591391-140591413 CTGAGTCAGGACATGGGGCTGGG + Intronic
999525074 5:152396261-152396283 CTTTGCTATGACATGACTCTTGG + Intronic
1000535395 5:162472130-162472152 CTGTGTTAGGTCACTGCTCTGGG + Intergenic
1001552354 5:172612159-172612181 CTGAGACAGGACAAGGCTCTGGG - Intergenic
1002869130 6:1149832-1149854 CTGTCCTAGGACATGGTTGTGGG + Intergenic
1007352734 6:41285793-41285815 CTGTGCTCAGACATTGCTCTGGG - Intronic
1007412970 6:41675390-41675412 CTGGGTCAGGCCCTGGCTCTTGG + Intergenic
1007450580 6:41938503-41938525 CTGAGTTAGGAGTTGGCTCCTGG - Intronic
1009797735 6:68494357-68494379 ATGTTTTAGGACATTGGTCTAGG + Intergenic
1010382048 6:75236613-75236635 CTGTGTTAGAAATTGGTTCTGGG - Intergenic
1010393928 6:75369060-75369082 CTGTGTTAGCTCAAGGTTCTTGG + Intronic
1010440029 6:75883404-75883426 TTCTTTTAGGACATGGTTCTTGG + Intronic
1010665601 6:78626233-78626255 CTGTGATGGGACATGGATTTGGG - Intergenic
1011644802 6:89447381-89447403 CTGGGTTAGGCCTTGGCTTTAGG - Intronic
1013670387 6:112396050-112396072 GTGTTTTAGGACATTGGTCTGGG - Intergenic
1014474612 6:121857173-121857195 CTGTGGTAGAAGATGCCTCTGGG - Intergenic
1015008799 6:128317746-128317768 TTGTATGAGAACATGGCTCTTGG - Intronic
1021846698 7:24770006-24770028 GTGTTTAATGACATGGCTCTTGG + Intergenic
1022103215 7:27181274-27181296 CTGTGTTAAGAAATGTCTGTTGG - Intergenic
1023753480 7:43394130-43394152 CTGTGCCTGGACATGGCTGTGGG - Intronic
1024188030 7:46974528-46974550 CTGGGATATGACATGGTTCTGGG + Intergenic
1026791131 7:73332634-73332656 CTGTGTTTTGACGTGGTTCTTGG + Intronic
1029587995 7:101487478-101487500 CTCTCTCACGACATGGCTCTCGG + Intronic
1029699368 7:102236340-102236362 CTGAGGTAGGCCATGCCTCTTGG + Intronic
1034201825 7:149287495-149287517 CTGTATTTGGGAATGGCTCTGGG + Intronic
1034426237 7:151015714-151015736 CTGTGGGAGGAGACGGCTCTTGG + Intronic
1034960269 7:155360387-155360409 CTGTGTTTGGCCATGGCTGTTGG - Intronic
1035155119 7:156906099-156906121 CTGTTCTAGGGCATGGTTCTGGG - Intergenic
1039244680 8:35595853-35595875 CTGTGTTTGCACAAGGCCCTTGG + Intronic
1040846353 8:51846142-51846164 CTGTGTTAGCCCATGGTTTTAGG - Intronic
1040880242 8:52197065-52197087 CTTTGCTAGGACCTGGCTTTTGG - Intronic
1045870844 8:106925178-106925200 CTGGCTTAGGACATGGGCCTGGG + Intergenic
1046970426 8:120216864-120216886 CTCTGTTTGGACATGGGTCATGG - Intronic
1050828493 9:9981032-9981054 CTTTGTTAGGAAATAGATCTTGG - Intronic
1056684389 9:88747422-88747444 CTTTGTAGGGACAGGGCTCTAGG + Intergenic
1056787092 9:89601056-89601078 CTATGTCAGCACAGGGCTCTTGG - Intergenic
1058129922 9:101239968-101239990 ATGTTTTAGGACATTGGTCTAGG - Intronic
1058348378 9:103991705-103991727 GTGTGTTAAGACATAACTCTGGG - Intergenic
1061153961 9:128846000-128846022 CAGAGTTAGGACATGGCCTTGGG - Intronic
1061828166 9:133274768-133274790 CTGGACTAGGACAAGGCTCTGGG - Intronic
1061949103 9:133926314-133926336 CCCTCTTAGGACTTGGCTCTGGG - Intronic
1062228894 9:135470062-135470084 CTGTTTTAGGACAAAGTTCTTGG - Intergenic
1203431277 Un_GL000195v1:93225-93247 CTGTGTCAGCAAACGGCTCTGGG - Intergenic
1203435229 Un_GL000195v1:131398-131420 CTGTGTTAGCAAAGGGCTCTGGG + Intergenic
1186046421 X:5541600-5541622 CTGTATTAGAACATGGCTTTTGG - Intergenic
1189529222 X:41862216-41862238 CTGTGTTTTGACTTGGCTGTAGG - Intronic
1191716405 X:64196808-64196830 CTGTGGGGGGACATGGCTCTGGG - Intronic
1192161473 X:68791358-68791380 CTGTTTTAGGCCATGCCTCAAGG + Intergenic
1193337368 X:80306696-80306718 CTGTGTCAGGACTTGACTCTTGG - Intergenic
1193555759 X:82951818-82951840 CAGTTTTAGAACTTGGCTCTTGG - Intergenic
1196919491 X:120571068-120571090 CTGGGATAGGAGATTGCTCTAGG + Intronic
1198870645 X:141174965-141174987 CTGTGTGAGGCCATTGCTCCAGG - Intergenic
1199250462 X:145655805-145655827 TTTTGTTAGAACATGGCTCTGGG - Intergenic
1199451278 X:147981394-147981416 CTATGTGAAGACATGGCTCCGGG - Exonic
1200150829 X:153950613-153950635 CTGTGTTAGAAAATGGCTTATGG - Intronic