ID: 951045790

View in Genome Browser
Species Human (GRCh38)
Location 3:18037077-18037099
Sequence CTCTACAGTGAAGACACCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951045790 Original CRISPR CTCTACAGTGAAGACACCTT TGG Intronic
901350463 1:8591046-8591068 CTTTATAGTGAACACACATTTGG - Intronic
901684482 1:10936021-10936043 CTCTACTGTGCAGAGGCCTTGGG + Intergenic
901829983 1:11886429-11886451 CTCTCCAGGGAAAACACCTTGGG + Intergenic
902291533 1:15438595-15438617 CTCTCCAGGTAAGACACTTTGGG + Intronic
903777377 1:25801202-25801224 CTGCTCAGTGAAGACACCGTTGG - Intronic
904161221 1:28523429-28523451 CTCTACAGAGAAGAAAACTGAGG - Intronic
904213202 1:28899186-28899208 CTCTACAGTGCAGAAAACTGAGG - Intronic
905715518 1:40146038-40146060 CTCTACAGAAAAGTCAGCTTGGG - Intergenic
906627210 1:47334599-47334621 TTCTAGAGTAAAGACACGTTCGG - Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
908634289 1:66145272-66145294 CTCTCCAGTGCAGGCACCTAAGG + Intronic
909194266 1:72596444-72596466 TTCTCCAGTGAAGACTACTTTGG - Intergenic
909849061 1:80436553-80436575 CTCTGCAATAATGACACCTTGGG - Intergenic
911630434 1:100177513-100177535 CTTTGCTGTGAAGAAACCTTGGG + Intronic
912747247 1:112255197-112255219 ATCTTCTGTGAAGACTCCTTGGG - Intergenic
913551274 1:119919306-119919328 CTTTACCTGGAAGACACCTTGGG + Exonic
916446374 1:164876065-164876087 CTCCACTCTGGAGACACCTTAGG - Intronic
916735214 1:167601545-167601567 CTCTAATCTGAAGACATCTTTGG + Intergenic
916869622 1:168898975-168898997 CTTTTCAGTGAAGCCATCTTTGG - Intergenic
918400326 1:184156479-184156501 CTCTAAACTGAAACCACCTTTGG - Intergenic
918830078 1:189384554-189384576 CTCTCCAGTGAACCCAACTTAGG - Intergenic
919019083 1:192080320-192080342 CACAACATTGAAGACTCCTTAGG + Intergenic
919530448 1:198712084-198712106 TTCAACAGTGAATACACATTTGG - Intronic
919973312 1:202594623-202594645 CTCTACCATGACCACACCTTTGG + Exonic
924603977 1:245516496-245516518 CTATACAGTGAATACACTGTGGG + Intronic
1063573751 10:7242242-7242264 CTGTCCAGTGGAGACACCTGTGG - Intronic
1064738668 10:18409954-18409976 CTCTCCAGAGAATAAACCTTTGG + Intronic
1067370898 10:45680799-45680821 CTCTACAGTGATGAAATCTCTGG - Intergenic
1067388881 10:45845346-45845368 CTCTACAGTGATGAAATCTCTGG + Intronic
1067502598 10:46818496-46818518 CTCTACAGTGATGAAATCTCTGG - Intergenic
1068182542 10:53540498-53540520 CTCTACAATCAAGACTTCTTTGG + Intergenic
1068977660 10:63028230-63028252 CTATACAGTGAAGATAAATTTGG - Intergenic
1070331359 10:75419780-75419802 CTCTACAGTGGAGAGATCTAAGG - Intergenic
1070388560 10:75949144-75949166 CTCTACAAAGAAAAGACCTTAGG + Intronic
1070533629 10:77359159-77359181 CTGGACAGTGAGGACACCTCTGG - Intronic
1072503342 10:96041268-96041290 CTCTAAAGTGAAGGCATGTTTGG - Intergenic
1076509393 10:131001594-131001616 CTGTGCAGTGCAGACACCTGCGG + Intergenic
1078828182 11:14951664-14951686 CTGTACAGTGAGGAAAACTTAGG - Intronic
1079482142 11:20892609-20892631 TTCTACTGTGAAGACACATGCGG + Intronic
1079873114 11:25824603-25824625 CTTTTCAGTGAAAACACCTCTGG + Intergenic
1079943700 11:26715034-26715056 GTCTGTGGTGAAGACACCTTGGG + Intronic
1081922008 11:46787080-46787102 CACTGCAGTGTTGACACCTTAGG - Intronic
1082773419 11:57227291-57227313 TTCTACATTGTAGACAGCTTTGG - Intergenic
1083689156 11:64396292-64396314 CTCTGCAGCGGAGACACCTCGGG - Intergenic
1085079686 11:73624013-73624035 CTATACAAAGAAGAAACCTTGGG + Intergenic
1087816326 11:102663000-102663022 TTCTGCAGTGATGGCACCTTAGG - Intergenic
1089013624 11:115149194-115149216 CTCTACAGGGAAGTGGCCTTGGG - Intergenic
1089095471 11:115916609-115916631 CACTACAATGTAGACAGCTTAGG - Intergenic
1090637402 11:128698790-128698812 CTTTACACTAAAGACACCTCTGG + Intronic
1091882258 12:3989488-3989510 CTCCTCTGTGAAGACACCCTTGG + Intergenic
1094650583 12:32371993-32372015 CTCTGCAGTGCAGCCACCTGTGG - Intronic
1095086746 12:38064739-38064761 CTCTACACTGAGGACATTTTTGG + Intergenic
1096118256 12:49069092-49069114 CCCCACAGGGAAGACATCTTTGG - Exonic
1098355373 12:69607764-69607786 ATCTACAGTGAAAACATTTTTGG + Intergenic
1100714855 12:97294902-97294924 ATCTACAGTGTAGACCCCTTAGG - Intergenic
1104041793 12:125135519-125135541 CTGTACAGTGGAGTCACCTGTGG + Intronic
1104329530 12:127831546-127831568 CTATACAGGGATGACACTTTTGG - Intergenic
1105774255 13:23642261-23642283 CTATACAGTGGAGAGGCCTTTGG - Intronic
1106194408 13:27480972-27480994 CTCAACTGTGAAGATAACTTGGG + Intergenic
1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG + Intergenic
1112517066 13:100063164-100063186 CTCTACAGTGATGACTCTCTAGG + Intergenic
1114207138 14:20582582-20582604 TCCTACAGAGAAGAGACCTTTGG + Intergenic
1114452132 14:22834280-22834302 CTCTTCAGTGAAGCCCCTTTGGG - Exonic
1119811701 14:77526268-77526290 CTCTGCAGTGAAAAATCCTTGGG - Intronic
1120370908 14:83634112-83634134 CTTTACAGTGAAAACACCAGAGG - Intergenic
1120405750 14:84091497-84091519 CTCTGCAGAGAGGAGACCTTGGG - Intergenic
1122729097 14:103781950-103781972 CTGTACAGTTAAAAGACCTTTGG - Intronic
1128183790 15:65626872-65626894 CTCTAAAGTGAGGGTACCTTAGG + Intronic
1128490846 15:68142304-68142326 CTGTACTGTGAAGTCACATTTGG - Exonic
1129432811 15:75513338-75513360 CACTTCAGTGAAGAGGCCTTTGG + Intronic
1131254312 15:90851932-90851954 CTTTCCAGTGAAGCAACCTTGGG + Intergenic
1131642897 15:94311861-94311883 CAGTACAGTGAGGACAACTTGGG + Intronic
1132404419 15:101533594-101533616 CTCGACCCTGGAGACACCTTGGG - Intergenic
1132414458 15:101610524-101610546 CTCAACAGAGGGGACACCTTGGG + Intergenic
1135094780 16:19555865-19555887 TTCTACGGTCAAGACAACTTGGG - Intronic
1137031315 16:35526860-35526882 CCCTATATTGAAGACACCTGGGG - Intergenic
1137995641 16:53208312-53208334 CTCTTCACTGAAGACATTTTTGG - Intronic
1141977557 16:87527530-87527552 TTTTACAGTGAAGACAACTGAGG - Intergenic
1143412764 17:6721750-6721772 CTCAACAGTGTATACACATTTGG + Intergenic
1144452531 17:15392937-15392959 TTCTACGATCAAGACACCTTGGG - Intergenic
1145759661 17:27419013-27419035 CTCACCAGTGAAGCCACTTTAGG - Intergenic
1145799384 17:27673324-27673346 CTGAACAGTGAAGCCACTTTAGG + Intergenic
1146159633 17:30552965-30552987 CTCACCAGTGAAGCCACTTTAGG - Intergenic
1146844750 17:36175557-36175579 CTGAACAGTGAAGCCACTTTAGG + Intronic
1146857056 17:36263492-36263514 CTGAACAGTGAAGCCACTTTAGG + Intronic
1146863561 17:36324883-36324905 CTGAACAGTGAAGCCACTTTAGG - Intronic
1146872966 17:36387402-36387424 CTGAACAGTGAAGCCACTTTAGG + Intronic
1146880324 17:36438488-36438510 CTGAACAGTGAAGCCACTTTAGG + Intronic
1147066421 17:37925471-37925493 CTGAACAGTGAAGCCACTTTAGG - Intronic
1147075850 17:37988027-37988049 CTGAACAGTGAAGCCACTTTAGG + Intronic
1147077953 17:38005032-38005054 CTGAACAGTGAAGCCACTTTAGG - Intronic
1147087375 17:38067573-38067595 CTGAACAGTGAAGCCACTTTAGG + Intronic
1147093889 17:38128967-38128989 CTGAACAGTGAAGCCACTTTAGG - Intergenic
1147103319 17:38191536-38191558 CTGAACAGTGAAGCCACTTTAGG + Intergenic
1149399899 17:56285357-56285379 TTCTAGAGGGAAGATACCTTGGG - Intronic
1150086249 17:62274622-62274644 CTGAACAGTGAAGCCACTTTAGG + Intronic
1150597069 17:66615659-66615681 CTTTACAGTGGAGGCACCTCTGG - Intronic
1155645564 18:28073245-28073267 CTCTACATTGAAAACATGTTGGG - Intronic
1157131647 18:45013115-45013137 CTCTACTGTGCAGACACCACGGG - Intronic
1157741532 18:50097522-50097544 TTGTTCAGTGAAGTCACCTTAGG - Intronic
1160451185 18:78966850-78966872 TCCTACAGTGAAGAAACCTCTGG - Intergenic
1164640569 19:29822425-29822447 CCCTGCAGTGAAGACATCGTGGG - Exonic
1167401719 19:49276268-49276290 TTCTTCAGTGAAGCCATCTTTGG - Intergenic
1168259617 19:55186098-55186120 GTCTACACTGAAGACGCCTGGGG + Intronic
1168591844 19:57642832-57642854 CTTTACAGAGTAAACACCTTTGG + Intergenic
927247174 2:20966634-20966656 CTCTACAGTTAAGACAGGGTAGG + Intergenic
928939068 2:36708817-36708839 CTCTACTGTGCAGACAGCATTGG - Intronic
929619227 2:43337372-43337394 TTCTACAGTGAAAACAACTGGGG - Intronic
931055113 2:58460987-58461009 CTCCACAATCAAGACACCTTGGG - Intergenic
933285612 2:80381627-80381649 CACTAGAGTGGAGATACCTTTGG + Intronic
936415810 2:112309972-112309994 ACCTACAGTGATGACAACTTCGG + Exonic
936415812 2:112309996-112310018 AACTACAGTGATGACAACTTTGG + Exonic
936496706 2:113028586-113028608 CTCTGCTGTGCAGTCACCTTTGG + Intronic
939831344 2:147075345-147075367 ATTCAAAGTGAAGACACCTTGGG + Intergenic
942017846 2:171834950-171834972 TTTAACAGTGAAGACTCCTTTGG - Intronic
944696589 2:202206695-202206717 TTCTTCAGTGAAGCCATCTTTGG + Exonic
945846931 2:214956693-214956715 TTCTACAGTGAAAACAACCTAGG - Exonic
945948705 2:216018673-216018695 CTCTCCAGAGAAGTCACATTAGG + Intronic
947133221 2:226951545-226951567 CTCTACAGTGAAGTTCCCATAGG - Intronic
947655169 2:231820620-231820642 CTGTACTGTTAAGACTCCTTGGG - Intergenic
1172421700 20:34824525-34824547 CCTTCCAGGGAAGACACCTTGGG + Intronic
1182188287 22:28431006-28431028 CTCTACCGTGAAGACTCTCTTGG + Intronic
1185150608 22:49161671-49161693 CTCTGCAGAGGAGACACCTGAGG + Intergenic
950877803 3:16293049-16293071 TTCTACAATGAAAACACCTGGGG + Intronic
951045790 3:18037077-18037099 CTCTACAGTGAAGACACCTTTGG + Intronic
952246310 3:31596428-31596450 CTCTGGAGTGTAGACACCTAAGG + Intronic
952316185 3:32234514-32234536 CTGTACAGTGGAGAAACCTTTGG - Intergenic
952533252 3:34284002-34284024 CTCTACAGTGAGGTCATTTTAGG - Intergenic
953838573 3:46369212-46369234 CTCTACAGTTAAGAAAACTAAGG + Intergenic
957142434 3:76378250-76378272 CTCAACAATGGAGACAACTTAGG + Intronic
960540193 3:118853598-118853620 CTCTATAGTGAAATCATCTTGGG + Intergenic
962450320 3:135508647-135508669 CTCTAGACTGAACACAGCTTTGG + Intergenic
962900046 3:139754146-139754168 CTGTACAGTAAAAACACCTAGGG - Intergenic
962951562 3:140224439-140224461 CTAGACAGTGAAGACACATCAGG + Intronic
964105075 3:153030450-153030472 CTTTACAGTCAAGTCACATTAGG - Intergenic
964158289 3:153613804-153613826 CTTTAACGTGAATACACCTTAGG + Intergenic
964301157 3:155286559-155286581 ATCTATAGAAAAGACACCTTGGG - Intergenic
964642109 3:158919594-158919616 CTCTAAAATGAAGATACCATTGG + Intergenic
964938746 3:162128078-162128100 GTTTAAAGTGAAGACACTTTTGG + Intergenic
965803019 3:172513583-172513605 CTCTACTGTGAAAACAGCTCAGG + Intronic
967188647 3:186966651-186966673 CACTACAAGGAAGAGACCTTGGG - Intronic
967528967 3:190527501-190527523 CCCTGCAGTGAAGACACATTTGG + Intronic
967571061 3:191028765-191028787 CTCTACTGTAACCACACCTTTGG + Intergenic
968339888 3:197946548-197946570 CTTTACAGTGAAAACCCCTATGG + Intronic
968700696 4:2056594-2056616 CACCACAGTGGAAACACCTTAGG - Intergenic
968933619 4:3597599-3597621 CTGCACATGGAAGACACCTTTGG - Intergenic
969172776 4:5377117-5377139 CTCTAGAATCAAGACTCCTTTGG - Intronic
971089224 4:23320776-23320798 CTGTCCAGTGAAGACATATTTGG - Intergenic
972667456 4:41180848-41180870 CTATACAATGAAAACAGCTTTGG - Intronic
974006049 4:56558272-56558294 CTCTACAGTCAAGAAAAATTTGG - Intronic
977682082 4:99807894-99807916 CGTTACAGTGAAGGCAGCTTGGG - Intergenic
978100880 4:104840192-104840214 CTTGACAGTGAAGACATGTTAGG + Intergenic
985107516 4:186513696-186513718 CTCTACACTGCAGACAGCATGGG - Intronic
986200373 5:5573596-5573618 CTCCACAGGGAAGACATCCTCGG - Intergenic
990085991 5:51978324-51978346 CTTTACAGAGAAGATACCATTGG - Intergenic
990127893 5:52541196-52541218 CAGTACAGTGAAGACCTCTTTGG - Intergenic
990942703 5:61219421-61219443 GTCTACAGTGAAGACATGTGGGG - Intergenic
994342365 5:98645931-98645953 TTCTTCAGTGAAGCCATCTTTGG - Intergenic
994606593 5:101975182-101975204 CTCTACATTGAAATCACCTCTGG - Intergenic
995485679 5:112637903-112637925 CTCTAGACTGAAGACAATTTTGG - Intergenic
999011511 5:148046505-148046527 CACTACACAGAAGAAACCTTGGG + Intronic
999432232 5:151534439-151534461 CACCACAGTGAAGACCCCTGTGG - Exonic
1003093219 6:3121620-3121642 TTCTACAGTTAAGATAGCTTAGG - Intronic
1004967003 6:20863405-20863427 CTCTTCAGTAAAGACCCCTTGGG + Intronic
1010543811 6:77124960-77124982 CTCTACAGTCACGCCACCTTGGG + Intergenic
1012230606 6:96756980-96757002 CCCTACAGTGAAGCCACCTCTGG + Intergenic
1015389630 6:132666715-132666737 CTTTACATTGAAGACACTGTGGG - Intergenic
1018523473 6:164679534-164679556 CTCAACACTGAAGACAGCTCAGG + Intergenic
1019063781 6:169277975-169277997 CTTTACAGAGAAGCCACCTGAGG + Intergenic
1019175356 6:170156758-170156780 CTCTCCTGTGCAGACACCATAGG + Intergenic
1021541795 7:21767749-21767771 CTCTACAGAAAAGACACCACAGG - Intronic
1021663727 7:22950204-22950226 CTTTACAGTGAAGTCTCCCTTGG + Intronic
1023036811 7:36138377-36138399 CTCCAGAGTCTAGACACCTTTGG + Intergenic
1023246237 7:38207441-38207463 CCCTAAAGAGAAGACACCTTTGG - Exonic
1024422082 7:49180207-49180229 ATCTACAGTGTGGACAACTTTGG + Intergenic
1027476501 7:78638288-78638310 CTCTACACTGAAGACAAACTAGG + Intronic
1027694997 7:81399288-81399310 CTTTACAGGGAAGAGACTTTAGG - Intergenic
1029223252 7:99006913-99006935 CTCCCCAGTGACGTCACCTTGGG - Intronic
1031538882 7:122968817-122968839 CGATACAGTGAAGAAACTTTGGG + Intergenic
1033022485 7:137740363-137740385 CTCTACAGGGAGGACCCCTGAGG + Intronic
1033713481 7:143974748-143974770 GTCTTCAGTGATGCCACCTTTGG - Intergenic
1035453711 7:158996083-158996105 CTTTAAAGTGCAGACACCCTCGG - Intergenic
1036018152 8:4809524-4809546 CTCTTCAGTAAAGAGGCCTTAGG + Intronic
1036705479 8:11043193-11043215 CTCTTCAGTAAAGACGCATTGGG - Intronic
1038038372 8:23704943-23704965 CCGGACAGGGAAGACACCTTCGG - Intronic
1038969174 8:32612374-32612396 TTTTACAATGAAGACTCCTTTGG + Intronic
1039048124 8:33468512-33468534 TTATCCAGTGAAAACACCTTGGG - Intronic
1046572451 8:115983548-115983570 CTCTAAAGTGTAGGCAACTTTGG + Intergenic
1049920992 9:364084-364106 CTCTGCAGTGCAGATACTTTTGG - Intronic
1050046269 9:1549422-1549444 CTCTATAGTGAAGAAACCTTTGG + Intergenic
1050132516 9:2427426-2427448 CTTGACAGAGAAGACAGCTTGGG + Intergenic
1051773038 9:20600543-20600565 CTCTATAGAGAAGAAACATTTGG - Intronic
1054456526 9:65434218-65434240 CTGCACATGGAAGACACCTTTGG + Intergenic
1055218895 9:73903831-73903853 CTATAGAGTGAAGAAAACTTAGG - Intergenic
1059096582 9:111422600-111422622 CTCTACAGTGAAAGGAGCTTTGG - Intronic
1059502852 9:114770283-114770305 TTCAACAGTGGATACACCTTGGG - Intergenic
1059613920 9:115928442-115928464 CTCTACAGCAAAGACACCTGAGG - Intergenic
1185952842 X:4455532-4455554 CACTACAGTGAAAACAGCATGGG - Intergenic
1189038642 X:37518879-37518901 CACTACAGGGAAGGCACCTGAGG - Intronic
1190527415 X:51342049-51342071 CTCTACAGTGAAGAAGTCTCAGG + Intergenic
1192387884 X:70691966-70691988 CTCTACAGTTAGGACATGTTTGG - Intronic
1197823079 X:130561256-130561278 CCCCACAGTGAAGGCACCTCTGG - Intergenic
1198482924 X:137057285-137057307 CTCTACAGTGAAGAACTCTTTGG + Intergenic
1198787870 X:140310952-140310974 ATCTACAGTGAACTCACTTTTGG + Intergenic
1199476539 X:148252802-148252824 CTTTACAGTGAAGATTCCTATGG + Intergenic
1199861227 X:151801700-151801722 GTCTACAGTGAGGACACCTGGGG + Intergenic
1200067997 X:153514194-153514216 CTCTGAAGTGAGGACCCCTTTGG - Intergenic
1201856816 Y:18553565-18553587 CTATAGAGTGAACACACCATGGG - Intronic
1201876505 Y:18766815-18766837 CTATAGAGTGAACACACCATGGG + Intronic
1202170430 Y:22038009-22038031 CTCTAGAGTGAACACACCATAGG + Intergenic
1202220934 Y:22548364-22548386 CTCTAGAGTGAACACACCATAGG - Intergenic
1202322178 Y:23647299-23647321 CTCTAGAGTGAACACACCATAGG + Intergenic
1202548590 Y:26022757-26022779 CTCTAGAGTGAACACACCATAGG - Intergenic