ID: 951048811

View in Genome Browser
Species Human (GRCh38)
Location 3:18071424-18071446
Sequence TGATAGGTATATAACCTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951048808_951048811 26 Left 951048808 3:18071375-18071397 CCTACTTACTGTTTTCTTTGTCT 0: 1
1: 0
2: 6
3: 87
4: 948
Right 951048811 3:18071424-18071446 TGATAGGTATATAACCTTATTGG 0: 1
1: 0
2: 2
3: 14
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951048811 Original CRISPR TGATAGGTATATAACCTTAT TGG Intronic
902176628 1:14655380-14655402 TGGTAGGGATATAAATTTATCGG - Intronic
902312773 1:15594397-15594419 TGATAAGTGTGTAACTTTATAGG - Intergenic
904635629 1:31878637-31878659 TAATAAGTGTATTACCTTATAGG + Intergenic
906426590 1:45719108-45719130 TAATAGGTATATATATTTATGGG - Intronic
909377663 1:74958559-74958581 TGATAGTGATGTAACGTTATAGG + Intergenic
909582858 1:77257596-77257618 TAATAGGTATATATATTTATGGG - Intergenic
911820805 1:102417955-102417977 TGTCAAGTTTATAACCTTATAGG - Intergenic
912311266 1:108623633-108623655 TAATAGGTATATACATTTATGGG - Intronic
918413721 1:184286516-184286538 TGAGAGGCAGATCACCTTATTGG - Intergenic
918594030 1:186272038-186272060 TTATAGGTATATATATTTATGGG + Intergenic
920596169 1:207272608-207272630 TAGTAGGTATATATACTTATGGG + Intergenic
920752952 1:208698769-208698791 TGATAGGTATATGAACCTGTTGG + Intergenic
921044482 1:211464576-211464598 TAATAGGTATATATATTTATGGG - Intergenic
923923272 1:238593767-238593789 TGAAAAGTCTAGAACCTTATTGG + Intergenic
1062931518 10:1355685-1355707 TGATAAGTATTTAAGCCTATAGG - Intronic
1065195705 10:23263346-23263368 CTATAGGTATATAATATTATAGG - Intergenic
1066491590 10:35899816-35899838 TGATAGGTGTATATATTTATGGG + Intergenic
1067713559 10:48669909-48669931 TAGTAGGTATATATACTTATGGG - Intergenic
1068380423 10:56246946-56246968 TGGTAGGTATATATATTTATGGG + Intergenic
1077935384 11:6779863-6779885 TGATATGTATTTAAACCTATGGG - Intergenic
1078049946 11:7955111-7955133 TCATAGGTATTTAAAATTATTGG - Intergenic
1080849091 11:36052449-36052471 TAACAGGGATATAATCTTATTGG - Intronic
1081357855 11:42135130-42135152 TAGTAGGTATATATACTTATGGG - Intergenic
1086276867 11:85140456-85140478 TGATAGTTATATATATTTATAGG + Intronic
1088253579 11:107882395-107882417 TAACTGGTATATGACCTTATAGG + Intronic
1088323823 11:108581955-108581977 TGATAGATATAGAACTTTTTCGG - Intronic
1091532135 12:1368787-1368809 TGATAGGTATACTAGCTTTTAGG - Intronic
1092574899 12:9771195-9771217 AGATAGATACATAATCTTATTGG - Intergenic
1092769058 12:11880425-11880447 TGATAAGTAGATAACATTCTAGG + Intronic
1092936882 12:13372325-13372347 TGGTAGGTATATATATTTATGGG + Exonic
1093415296 12:18913580-18913602 TTATAAGTGTATAAACTTATAGG - Intergenic
1093569484 12:20650032-20650054 TGGTAGGTATATATATTTATGGG + Intronic
1094154325 12:27321888-27321910 TGGTAGGTATATATATTTATAGG - Intronic
1094265470 12:28554452-28554474 TGATATGTATGTAACCTCTTGGG + Intronic
1097387875 12:58972218-58972240 TAGTAGGTATATATACTTATTGG + Intergenic
1098062273 12:66575394-66575416 TCATAGGAATATAAACTTTTTGG - Intronic
1098129493 12:67334312-67334334 TAATAGGTATATATATTTATGGG + Intergenic
1098431612 12:70425713-70425735 TGTTAGGAATCTAACCTGATGGG + Intronic
1099175110 12:79412330-79412352 TAACTGGTATATTACCTTATAGG - Intronic
1101571512 12:105958104-105958126 TAACTGGTATATGACCTTATAGG + Intergenic
1103395506 12:120603905-120603927 TCATAGGTACATATACTTATGGG - Intergenic
1106198140 13:27511396-27511418 TAATAGGTATATATATTTATGGG + Intergenic
1107346087 13:39462529-39462551 TGAATGATATATAACTTTATAGG - Intronic
1108123501 13:47215210-47215232 TAATAGGTATATATATTTATGGG + Intergenic
1108483007 13:50894409-50894431 TGACTGGTATATGACCTTCTAGG + Intergenic
1108982288 13:56531448-56531470 TGATAGGTATTTAACTGTGTTGG - Intergenic
1109128483 13:58549065-58549087 TCATTGATATATAACCTTAGGGG - Intergenic
1110276833 13:73650063-73650085 TGGTAGGTATATATATTTATAGG + Intergenic
1110806353 13:79758522-79758544 TAGTAGGTATATATACTTATGGG + Intergenic
1111422634 13:88035024-88035046 TGGTAGGTATATATATTTATGGG + Intergenic
1112228749 13:97566954-97566976 TAATAGGTATATATATTTATGGG - Intergenic
1114177669 14:20337673-20337695 TAATAGGTGTATAAATTTATGGG - Intergenic
1116106819 14:40518767-40518789 TAATAGGTATATATATTTATGGG - Intergenic
1117412935 14:55467325-55467347 GGATAGGTAAATAACCTTAAAGG - Intergenic
1118378376 14:65197077-65197099 TAATAGGTATATATATTTATGGG + Intergenic
1118490948 14:66259165-66259187 TTATACATATATAAACTTATAGG - Intergenic
1119947752 14:78712917-78712939 TGAAGGGTATATAACCTGAAGGG - Intronic
1120100859 14:80444315-80444337 TAATAGGTGTATATACTTATGGG - Intergenic
1120123204 14:80707858-80707880 AGATAGCTATATATCCTTAGTGG - Intronic
1122651175 14:103228068-103228090 TGATAGGTATATAGACCTATGGG - Intergenic
1124832732 15:33164810-33164832 TAGTAGGTATATATACTTATGGG + Intronic
1126521599 15:49601518-49601540 TGGTAGGTATATATATTTATGGG + Intronic
1126862316 15:52897632-52897654 TAATAGGTATATATATTTATGGG + Intergenic
1127913295 15:63435867-63435889 TCACTGGTATATGACCTTATAGG + Intergenic
1128298794 15:66549772-66549794 TAGTAGGTATATAAATTTATAGG + Exonic
1133517504 16:6523884-6523906 TAATAGGTATAGATACTTATGGG + Intronic
1133560151 16:6943209-6943231 TGAGGGCTCTATAACCTTATAGG - Intronic
1140095391 16:71871028-71871050 TGAAAGGTACATATCCTTTTAGG - Intronic
1141836004 16:86539923-86539945 TGATAGGTTTATAGGTTTATAGG - Intronic
1151051786 17:70986260-70986282 TAACTGGTATATAACCTTCTAGG - Intergenic
1153127123 18:1807884-1807906 TGATAGCTATCAAAACTTATAGG - Intergenic
1153606868 18:6842845-6842867 TGGTAGGTATATATATTTATGGG - Intronic
1153697862 18:7662818-7662840 TGATAGGTGTATATATTTATGGG - Intronic
1155418807 18:25631473-25631495 TGGTAGGTATATATATTTATGGG - Intergenic
1157420607 18:47544801-47544823 AGGTAGGTAAATAACCCTATTGG + Intergenic
1157953785 18:52071567-52071589 TGGTAGGTATATATATTTATGGG + Intergenic
1158080674 18:53586679-53586701 TAATAGGTATATATATTTATGGG - Intergenic
1159124209 18:64204365-64204387 TGATAGGTATATATATTTATGGG - Intergenic
1159842838 18:73419506-73419528 TAATAGGTATATATGTTTATGGG - Intergenic
930844893 2:55892609-55892631 TGACAAGTATGTAACTTTATAGG - Intronic
931068817 2:58621061-58621083 TGAGAGGTATTTAACCTCAGAGG - Intergenic
931533195 2:63240638-63240660 GGATTGGTATATAACATTAAGGG - Intronic
932061682 2:68506889-68506911 TTATATGTTTATAACCTTTTTGG - Intronic
932272991 2:70427200-70427222 TAGTAGGTATATATACTTATGGG - Intergenic
933326053 2:80838852-80838874 TAGTAGGTATATATCTTTATGGG + Intergenic
933368494 2:81386292-81386314 TAACAGGTATATGACCTTCTAGG + Intergenic
935229501 2:101083593-101083615 AGATAGGTAGATAACTTCATGGG - Intronic
936949316 2:117962170-117962192 TGATGTGTAAATAACCTTTTGGG - Intronic
939195143 2:138962431-138962453 TGATAGGTCCATGACCTTATTGG - Intergenic
941264014 2:163336642-163336664 TGATAGGTATATATTTTTAAAGG - Intergenic
941944731 2:171082527-171082549 TGATATGTATATATTCTTACTGG - Intronic
941983243 2:171483312-171483334 TGACAGGTACAAAACATTATGGG + Exonic
942102567 2:172600340-172600362 TTATAGTTATATAATCATATGGG - Intronic
942310514 2:174652552-174652574 TGATTGCTATATAGCCTTAATGG - Intronic
944353945 2:198762926-198762948 TGTTAGGTAAATAACCCAATGGG + Intergenic
944830209 2:203526260-203526282 TTATAGGTATATACATTTATGGG + Intronic
945541893 2:211098225-211098247 TGATAAGTATACTACCTGATGGG + Intergenic
947219803 2:227781380-227781402 TAATTGGTATATGACCTTATAGG + Intergenic
1171177032 20:23059903-23059925 TAATTGGTATATGACCTTCTAGG + Intergenic
1173235393 20:41240419-41240441 TGGTAGGTATATATATTTATGGG + Intronic
1174896194 20:54452368-54452390 TAACTGGTCTATAACCTTATAGG + Intergenic
1177673814 21:24270598-24270620 TTATAGGAATATTAACTTATTGG - Intergenic
1178172432 21:30056799-30056821 TAGTAGGTATATATACTTATGGG + Intergenic
1178547816 21:33507985-33508007 TGGTAGGTATATATATTTATAGG - Intronic
1181451040 22:23021406-23021428 TAATAGGTATATATATTTATGGG - Intergenic
1181922106 22:26328574-26328596 TGCTAGGTGTAAAACGTTATCGG + Intronic
1182880073 22:33725464-33725486 TGACAGGTAAATGACCTTGTTGG - Intronic
1182960825 22:34473397-34473419 TAGTAGGTATATATACTTATGGG + Intergenic
1183996958 22:41641341-41641363 TGGTAGGTGTATATACTTATAGG + Intronic
951048811 3:18071424-18071446 TGATAGGTATATAACCTTATTGG + Intronic
951102772 3:18708572-18708594 TAGTAGGTATATAAATTTATAGG - Intergenic
951423970 3:22520405-22520427 TTATAGGTATATATCTTTATGGG - Intergenic
952693440 3:36237496-36237518 TTATAGGTACATAATGTTATAGG - Intergenic
957168579 3:76708279-76708301 TCATAGGTATCCAACCTTCTAGG - Intronic
957463005 3:80546856-80546878 TAATAGGTATATAAATTTATGGG + Intergenic
959195856 3:103180828-103180850 TAATAGGTGTATATCTTTATAGG - Intergenic
959435643 3:106311825-106311847 TGGTAGGTATATACATTTATGGG + Intergenic
960401601 3:117206372-117206394 TAGTAGGTATATATACTTATGGG + Intergenic
960579732 3:119266782-119266804 TAATAGGTATATATATTTATGGG - Intergenic
963279988 3:143374658-143374680 TAATAGGTATATATATTTATGGG + Intronic
963542064 3:146604748-146604770 TAGTAGGTATATATACTTATGGG - Intronic
963938093 3:151074906-151074928 TCATAGGAATATAAGCTTTTTGG - Intergenic
965117606 3:164512405-164512427 TAATAGGTATATAAATTTATGGG + Intergenic
966985146 3:185173115-185173137 TGACAGGTATATAATTTTAGGGG + Intergenic
970212457 4:13724200-13724222 TAATAGGTATATATTTTTATGGG + Intergenic
971063655 4:23002195-23002217 TGATAATTATATAAAATTATTGG + Intergenic
972022362 4:34331884-34331906 TAATAGGTGTATATGCTTATTGG - Intergenic
972512336 4:39780542-39780564 AGATGAGTATATAACCCTATAGG - Exonic
972942236 4:44210433-44210455 TAATTGTTATATAACCTCATTGG - Intronic
974960149 4:68688743-68688765 TGATAGGTAATTAATGTTATTGG + Intergenic
975555438 4:75659755-75659777 TGATAGGTATATTACCTTAGGGG - Intronic
976111645 4:81681246-81681268 TGGGAGGTATATAACAATATTGG + Intronic
977280530 4:95034249-95034271 TAATAGGTATATATGTTTATTGG + Intronic
978143346 4:105342808-105342830 GGGTAGGTATATGACATTATGGG - Intergenic
979183166 4:117755857-117755879 TAACTGGTATATGACCTTATGGG - Intergenic
979395581 4:120184688-120184710 TAGTAGGTATATATACTTATGGG - Intergenic
979398896 4:120223504-120223526 TTATATATATATAACCTTAATGG + Intergenic
981530204 4:145745098-145745120 TAGTAGGTATATATACTTATGGG + Intronic
981725634 4:147844216-147844238 TAATAGGTATATATATTTATGGG + Intronic
981776262 4:148371065-148371087 TGGTAGGTATATATATTTATGGG + Intronic
981785864 4:148479057-148479079 TGATAAGCATATTACCTGATAGG + Intergenic
981835351 4:149046688-149046710 TGATATATATATAAACTAATAGG - Intergenic
983123385 4:163916931-163916953 TGATATGTATCTACCATTATAGG + Intronic
983468957 4:168132736-168132758 TAATAGGTATATATATTTATGGG - Intronic
984092926 4:175396877-175396899 GGATATGTCTATAACCTTGTTGG - Intergenic
986630655 5:9768797-9768819 TAATAGGTGTATATCTTTATGGG + Intergenic
986748498 5:10764132-10764154 TGACTGGTATATGACCTTCTAGG + Intergenic
987881161 5:23748378-23748400 TGATAGGTATATATCCACTTAGG + Intergenic
989277800 5:39610139-39610161 TGATAGTTATCTAACCTCAAGGG + Intergenic
989782278 5:45282129-45282151 TGATATGTATATAAGTTTAATGG + Intronic
990793508 5:59512303-59512325 AGAGAGGAATATAACCTTAATGG - Intronic
991671867 5:69055943-69055965 TAATAGGTATATATTTTTATGGG + Intergenic
992658104 5:78930301-78930323 GGACAGGTATATAACTTTTTTGG + Intronic
992755060 5:79896347-79896369 TAGTAGGTATATATCTTTATGGG + Intergenic
992759249 5:79937003-79937025 TGAAAGGTATATAATTTCATGGG - Intergenic
993179392 5:84531673-84531695 TAATAGGTATATATATTTATGGG - Intergenic
994226742 5:97260854-97260876 TAGTAGGTATATATCTTTATAGG - Intergenic
994479232 5:100311822-100311844 AGAAAGGGATATTACCTTATAGG + Intergenic
997573448 5:134953459-134953481 TTATAGGTATATAATTTTATAGG - Intronic
999555140 5:152732917-152732939 TGGTAGGTATATATATTTATGGG + Intergenic
1000357211 5:160410786-160410808 TGATATGTATATAAGCTTCCTGG + Intronic
1000499015 5:162024330-162024352 TGGTAGGTATATATATTTATGGG - Intergenic
1003993550 6:11513644-11513666 TAATAGGTATAAAACATTTTGGG + Intergenic
1005820378 6:29593606-29593628 TAACTGGTTTATAACCTTATAGG + Intronic
1008761195 6:54852795-54852817 TGATAGGGAGAAAATCTTATTGG + Intronic
1009488817 6:64260907-64260929 TAATAGGTATATATATTTATGGG + Intronic
1009785432 6:68331908-68331930 TAATAGGTATGCAGCCTTATGGG + Intergenic
1009943057 6:70311784-70311806 TAATAGGTATATATATTTATGGG - Intergenic
1010390344 6:75329799-75329821 TAGTAGGTATATACACTTATGGG + Intronic
1012714949 6:102656809-102656831 TAATAGGTATATATATTTATGGG - Intergenic
1015161518 6:130157307-130157329 TTTTTGGTATATAACTTTATAGG - Intronic
1015199918 6:130567896-130567918 TAGTAGGTATATATACTTATGGG + Intergenic
1016313755 6:142762920-142762942 TGATATGTCTATAACATTTTTGG - Intronic
1016349120 6:143148192-143148214 ATATAGGTTTATAATCTTATGGG - Intronic
1017313785 6:153004414-153004436 TCATTGGTATATAACACTATAGG - Intergenic
1018465717 6:164042839-164042861 TGATAAGTAAATACCCTGATTGG + Intergenic
1018917070 6:168139961-168139983 TGGTAGGTATATATATTTATGGG + Intergenic
1021226600 7:18035428-18035450 TTCTAGGTATACAATCTTATCGG + Intergenic
1023077027 7:36494462-36494484 TGGTAGGTATATATATTTATGGG + Intergenic
1025603258 7:63019123-63019145 TAATAGGTATATATATTTATGGG + Intergenic
1026207024 7:68266632-68266654 TGATAGTCATATAAGATTATTGG + Intergenic
1028026291 7:85844623-85844645 TAATAGGTGTATATCTTTATGGG - Intergenic
1028706115 7:93848866-93848888 TGGTAGGTATATATATTTATGGG + Intronic
1030476322 7:110037377-110037399 TAATAGGTATATATATTTATGGG + Intergenic
1031003928 7:116450925-116450947 TAATAATTATATAACATTATAGG - Intronic
1031273346 7:119684151-119684173 TGCTACATATACAACCTTATCGG - Intergenic
1031834082 7:126661281-126661303 TTGTAGGTATATATACTTATGGG - Intronic
1032807950 7:135376561-135376583 CAATAGGTATATAACCATAAAGG - Intronic
1032961111 7:137035748-137035770 TGTTATGCATATAACCTTTTGGG - Intergenic
1034019363 7:147625364-147625386 TCATAGGTATATATATTTATGGG - Intronic
1034047817 7:147948421-147948443 CAATAGGTATATATACTTATGGG - Intronic
1034050080 7:147974177-147974199 TGATATGTGTATAACCTTATAGG - Intronic
1035518760 8:259238-259260 TAGTAGGTATATATACTTATGGG + Intergenic
1037156376 8:15704523-15704545 AGATAGCTACATAACTTTATTGG + Intronic
1038677493 8:29636435-29636457 TGCTAGGAAAATAGCCTTATAGG - Intergenic
1039307788 8:36282166-36282188 TAGTAGGTATATATCTTTATGGG + Intergenic
1039728942 8:40253629-40253651 TAATAGGTATATATATTTATGGG + Intergenic
1041119888 8:54575419-54575441 TGCTAGGTATATATATTTATGGG + Intergenic
1041641698 8:60209510-60209532 AGATAGGCATAAAACCTTTTTGG - Intronic
1041866380 8:62579156-62579178 TCATAGGTATATATATTTATGGG - Intronic
1042099423 8:65258431-65258453 TGATAGGGTGAAAACCTTATAGG + Intergenic
1044171871 8:89063430-89063452 TAGTAGGTATATATACTTATGGG + Intergenic
1044763205 8:95544776-95544798 AAATAGAAATATAACCTTATTGG + Intergenic
1044888537 8:96806951-96806973 TAATAGGTATATACATTTATAGG - Intronic
1045807688 8:106184307-106184329 GGAAAGTTATATAACCTCATGGG - Intergenic
1046647830 8:116805212-116805234 TGTTAGTTATATAACCATATCGG + Intronic
1048063749 8:130947435-130947457 TGAAGGGTATATAACCTCTTTGG + Intronic
1052195886 9:25714358-25714380 TTAAAGGTATATATCGTTATAGG + Intergenic
1053225844 9:36356211-36356233 GGCCAGGTATATAACCTTAGTGG - Intronic
1055395867 9:75874310-75874332 TAGTAGGTATATATCTTTATGGG - Intergenic
1185759553 X:2679928-2679950 AGATAGGTAAACAACCTTGTGGG - Intergenic
1185928152 X:4170509-4170531 TGATTGGTATATCAAATTATGGG + Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1189098455 X:38164108-38164130 TGGTAGGTATATATATTTATGGG + Intronic
1190655087 X:52604674-52604696 TGGTAGGTGTATATTCTTATGGG + Intergenic
1190859765 X:54333116-54333138 AGGTAGGTATATAATCTTCTTGG - Exonic
1191708572 X:64121103-64121125 TGGTAGGCATATATCTTTATGGG + Intergenic
1192105657 X:68313957-68313979 TAATAGGTATATATACTTATGGG - Intronic
1192662739 X:73059418-73059440 TGGTAGGTATATATATTTATGGG - Intergenic
1192812132 X:74556483-74556505 TGGTAGGTGTATAACTTTATGGG - Intergenic
1193093455 X:77520419-77520441 TAATAGGTATATATATTTATGGG - Intronic
1193138604 X:78001337-78001359 TAATAGGTATATATATTTATAGG + Intronic
1193163155 X:78252095-78252117 TGATAGGTGTATACATTTATGGG + Intergenic
1193739270 X:85198626-85198648 TAATAGGTATATATATTTATGGG + Intergenic
1193823204 X:86191516-86191538 TAATAAGTATAGTACCTTATAGG - Intronic
1194079695 X:89444610-89444632 TGGTAGGTATATATATTTATGGG + Intergenic
1194161965 X:90464985-90465007 TAACTGGTATATAACCTTCTGGG - Intergenic
1194408167 X:93524068-93524090 TGGTAGGTATATATACTTATGGG + Intergenic
1194498867 X:94655298-94655320 TAACAGGTATCTGACCTTATAGG + Intergenic
1195238347 X:102925101-102925123 TGATAGGTGTATATATTTATGGG + Intergenic
1196937514 X:120744224-120744246 TAGTAGGTATATATACTTATGGG + Intergenic
1197421633 X:126242375-126242397 TAATAGGTATATATATTTATGGG - Intergenic
1197555841 X:127952032-127952054 TGATGGTTATACAACATTATGGG - Intergenic
1197878049 X:131132538-131132560 TCATAGGTATGTAATCTTATGGG + Intergenic
1198186891 X:134261728-134261750 TAGTAGGTATATAAGTTTATGGG - Intergenic
1198809208 X:140518515-140518537 TAATAGGTATATATATTTATGGG - Intergenic
1199916513 X:152347587-152347609 TCATAGGTATATATATTTATGGG - Intronic
1200508246 Y:4042730-4042752 TAACTGGTATATAACCTTCTGGG - Intergenic
1200682154 Y:6225500-6225522 TAGTAGGTATATATACTTATGGG + Intergenic