ID: 951051249

View in Genome Browser
Species Human (GRCh38)
Location 3:18096577-18096599
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2053
Summary {0: 1, 1: 11, 2: 217, 3: 570, 4: 1254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951051249 Original CRISPR CTGTCTTTGAAGAGGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr