ID: 951052807

View in Genome Browser
Species Human (GRCh38)
Location 3:18113657-18113679
Sequence CTGTCAAGATACAGAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951052807_951052811 17 Left 951052807 3:18113657-18113679 CCCACAATTCTGTATCTTGACAG 0: 1
1: 0
2: 1
3: 10
4: 213
Right 951052811 3:18113697-18113719 CCATGTACAACATTTTCTTGTGG 0: 1
1: 0
2: 0
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951052807 Original CRISPR CTGTCAAGATACAGAATTGT GGG (reversed) Intronic
900036779 1:417804-417826 CTTCCAAGTTACAGAATTTTTGG - Intergenic
900058407 1:653551-653573 CTTCCAAGTTACAGAATTTTTGG - Intergenic
902153672 1:14465424-14465446 CTGTCAAGCGAGAGACTTGTGGG - Intergenic
902664887 1:17930530-17930552 CTGTCCAGATGCAGAAATGAAGG - Intergenic
905287911 1:36896007-36896029 TTCTCAGGATACAGAATTATAGG - Intronic
906230202 1:44156121-44156143 CTATTAAAATACAGATTTGTGGG + Intergenic
908539175 1:65106339-65106361 CTGTCAAAATGCAGAATTCCAGG + Intergenic
911455222 1:98113849-98113871 CAGTCAAGAAATAGAAATGTGGG - Intergenic
911743452 1:101412786-101412808 CTGAAAAGATACAGAATGGCAGG + Intergenic
912236289 1:107854846-107854868 ATGTTAAAATACAGAATTTTAGG - Intronic
912364650 1:109123027-109123049 CAGTCAAACTACAGGATTGTGGG - Intronic
913167831 1:116205242-116205264 CAGTCAAGAAACAGATATGTTGG + Intergenic
913421235 1:118671980-118672002 CAGTGATGATACAGATTTGTTGG - Intergenic
916269628 1:162926720-162926742 CTGGGAAGAGATAGAATTGTTGG + Intergenic
916593644 1:166219986-166220008 CTGGCAGGATACAAAATTCTTGG + Intergenic
916636028 1:166669597-166669619 TTGTTAAGACACAGAATTGGGGG + Intergenic
917442058 1:175077041-175077063 CTGTAAAGATCCAGAATTAGGGG + Intronic
919608337 1:199714128-199714150 TTGTCAAAAAACAGATTTGTAGG - Intergenic
921533313 1:216312146-216312168 TTTGCAAGATACAGAATTCTAGG + Intronic
924206515 1:241717138-241717160 CAGTCAAGATACTGCATTATTGG + Intronic
924785927 1:247199592-247199614 CTGTCAGGAAACAGTATTTTGGG - Intergenic
1065528434 10:26645609-26645631 CTCTCAAGTTCCAGGATTGTGGG + Intergenic
1068230419 10:54164146-54164168 CAGACCAGATGCAGAATTGTCGG + Intronic
1070048259 10:72861400-72861422 TAATCAAGATAAAGAATTGTTGG + Intronic
1070378941 10:75862086-75862108 CTATCAACCTACAGAATTATGGG + Intronic
1071605280 10:86981685-86981707 CTTTCTAGACACAGAAATGTAGG + Intronic
1072216141 10:93288810-93288832 CTGTCATAATACAGGATTGAAGG - Intergenic
1074021714 10:109591398-109591420 CTGTAAAGAGGCAGAATTGCTGG - Intergenic
1074683641 10:115936786-115936808 TTGTCAAGTATCAGAATTGTTGG + Intronic
1076223503 10:128754480-128754502 CTTCCAGGCTACAGAATTGTGGG + Intergenic
1077347127 11:2066614-2066636 CTGTGATGATACAGTATTATAGG + Intergenic
1077762465 11:5117819-5117841 GTGTCAAGATAAAGAAAAGTTGG - Intergenic
1077982203 11:7311519-7311541 TTGTGTAGACACAGAATTGTTGG + Intronic
1079594660 11:22227569-22227591 TCATCAAGAAACAGAATTGTAGG + Exonic
1085275700 11:75298072-75298094 CTGTCAAGAAAGAGAATATTGGG + Intronic
1086298227 11:85395676-85395698 CTGTCAAGCTGCAGCATTGCAGG - Intronic
1086326241 11:85702914-85702936 ATGTTAAGATAGAGAATTTTAGG + Intronic
1086893639 11:92287557-92287579 CTGTCAAGAAGTAGAGTTGTAGG + Intergenic
1086918619 11:92559966-92559988 ATATCAAGGAACAGAATTGTTGG + Intronic
1087840244 11:102913000-102913022 CTGTAAAGAAACAGTTTTGTTGG + Intergenic
1089601918 11:119621616-119621638 CAGACAAGATAGAGAAATGTGGG - Intergenic
1093096627 12:14979333-14979355 CTGTGAAGACATAGAAATGTGGG + Intronic
1094661560 12:32474231-32474253 ATGTCTAGGTACAGAATTGCTGG - Intronic
1096561475 12:52438862-52438884 GTGTCAGGATACAGAAGTGAAGG + Intergenic
1097160063 12:57039768-57039790 CTGTTAAAATACAGATTTCTGGG + Intronic
1097345673 12:58489197-58489219 CTGTCAATACACAGGATGGTTGG - Intergenic
1097472180 12:60008434-60008456 CTGTGAAGATATAGAATAATGGG - Intergenic
1098090320 12:66894253-66894275 CTGAGGAGAGACAGAATTGTGGG - Intergenic
1098640407 12:72832181-72832203 CTGCCAAGACTCAGAATTGCTGG - Intergenic
1100216133 12:92450571-92450593 CGGTCAAAATACAAAAATGTAGG + Intergenic
1100330872 12:93580795-93580817 CTGACCAAATACAGAATTGATGG - Intronic
1103336262 12:120192389-120192411 CTGGCCAAATACAGAATTCTAGG + Intronic
1104770162 12:131356542-131356564 CTTTCAAGCTACAGATTTGAGGG + Intergenic
1105056033 12:133099903-133099925 CTCACAGGCTACAGAATTGTGGG + Intronic
1109059890 13:57601954-57601976 TTGTCAGGAAACATAATTGTAGG - Intergenic
1109644012 13:65228705-65228727 CTCTCAAGATAGAGAGTTGAAGG + Intergenic
1109719869 13:66261765-66261787 CTGGAAAGAGACAGACTTGTTGG - Intergenic
1112217403 13:97447516-97447538 CTGTCAAAATACAGAATGCAGGG - Intronic
1112467677 13:99658280-99658302 CTCTCAAGAGAAAGAATTTTAGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115724965 14:36203786-36203808 TTATCAAGAGACAGAAGTGTTGG + Intergenic
1118424123 14:65639552-65639574 CTATCAAAACAAAGAATTGTAGG - Intronic
1120154418 14:81076800-81076822 CTGTGAAGATACTGAATTAGAGG - Intronic
1121953959 14:98197447-98197469 ATGTGAAGATCCAGAACTGTGGG - Intergenic
1122525914 14:102384274-102384296 CTTTCCAGCTACAGAATTGTGGG - Intronic
1123196675 14:106623756-106623778 TTGAAAGGATACAGAATTGTGGG - Intergenic
1123196685 14:106623840-106623862 TTGAAAGGATACAGAATTGTGGG - Intergenic
1124550114 15:30672851-30672873 TTGGCAAAATACAGAATTCTGGG - Intronic
1125075261 15:35607125-35607147 CTCTCAATATAGAGAATTGGTGG + Intergenic
1126405920 15:48322390-48322412 CAATCAAAACACAGAATTGTAGG - Intergenic
1126558204 15:50014153-50014175 CTCACAAGCTACAGAAGTGTTGG + Intronic
1126578486 15:50220732-50220754 CTGTTTGGATACTGAATTGTAGG - Intronic
1127254415 15:57277114-57277136 CTGGCAAGGTATAGAATTCTAGG - Intronic
1130456416 15:84114460-84114482 CTCTCAAGATACATAACTGTAGG - Intergenic
1133480174 16:6162413-6162435 CTGTTAAAATACAGAAATCTGGG - Intronic
1133930179 16:10225830-10225852 GTGTCAAAATGCAGATTTGTGGG + Intergenic
1134640591 16:15826693-15826715 CTTTGAAGGTACAGGATTGTTGG + Intronic
1135693348 16:24563918-24563940 CTGTCAAGATCCCCATTTGTTGG - Intronic
1136641759 16:31570646-31570668 CTGGCAGGATACACAATTCTTGG - Intergenic
1136663625 16:31789036-31789058 CTGGCAGGATACAAAATTTTTGG + Intronic
1137784042 16:51122816-51122838 CTGTCAAAATGCAGAATTTCAGG + Intergenic
1138113632 16:54343275-54343297 CTGTCAAGAAACTGAACTCTGGG - Intergenic
1140340474 16:74154256-74154278 CTATTAAGATACAGAATATTTGG + Intergenic
1141840593 16:86571813-86571835 CTGCCAAGATGCAAAACTGTTGG - Intergenic
1142845722 17:2674398-2674420 ATTTCAAGATTCAGAATTGCTGG - Intronic
1144215082 17:13048307-13048329 CTGTTAAAATACAGATTTCTGGG - Intergenic
1147238568 17:39075591-39075613 GTATCAAGATCCAGGATTGTTGG + Intronic
1147878821 17:43641028-43641050 CTGTCCAGATGCTGAGTTGTTGG - Exonic
1153613210 18:6908825-6908847 CAGTCATGATACAGTTTTGTGGG + Intronic
1154005343 18:10522900-10522922 CCGTCAACATACAGACTTGCTGG - Intergenic
1155146212 18:23085835-23085857 AGGTTAAGATACAGGATTGTGGG + Intergenic
1155641411 18:28020260-28020282 CTGTTAAGTTACAGAATCTTAGG + Intronic
1156382296 18:36574680-36574702 ATGATAAGATACAAAATTGTTGG - Intronic
1157430694 18:47622147-47622169 ATGACAAGATACACAAATGTTGG + Intergenic
1160640306 19:125314-125336 CTTCCAAGTTACAGAATTTTTGG - Intergenic
928769474 2:34689361-34689383 CTCTCAAGATACACAGTTGTTGG + Intergenic
928822922 2:35384301-35384323 TTTTCTAAATACAGAATTGTAGG - Intergenic
930987474 2:57608075-57608097 CTGTCAAGATTCAAATCTGTAGG + Intergenic
931415636 2:62077972-62077994 GGGTTAAGATAAAGAATTGTGGG + Intronic
932008369 2:67950359-67950381 TTGTCTAGGTACAGAATTCTAGG + Intergenic
933099484 2:78234523-78234545 TTGGCTAGATACAGAATTCTTGG - Intergenic
934612089 2:95747638-95747660 ATGGCAAGATACAGAAGTCTAGG - Intergenic
934842058 2:97631810-97631832 ATGGCAAGATACAGAAGTCTAGG + Intergenic
936382267 2:111996710-111996732 CTGTCAAAAAACAGCATTGAAGG + Intronic
937929344 2:127192463-127192485 ATGTGAAGATACATAATTCTGGG - Intronic
937963141 2:127478735-127478757 CTATGATGATACAGAGTTGTGGG - Intronic
938170578 2:129071942-129071964 CTATAAAGATAAAGAATTGTAGG - Intergenic
938390631 2:130902258-130902280 CTGTCAAGAGACAGAAAGGAAGG - Intronic
944642083 2:201737998-201738020 CTATTAAAATACAGAATTTTTGG + Intronic
947064404 2:226205656-226205678 TTGTCAAGGTACAGAATTCTAGG + Intergenic
947110443 2:226713116-226713138 GTGTCAAGAAAGAGAACTGTTGG + Intergenic
947292253 2:228588930-228588952 GTGTCCAGAAGCAGAATTGTTGG + Intergenic
1168873201 20:1148533-1148555 ATGTAAAGATACAGATTGGTTGG - Intronic
1169386020 20:5150328-5150350 ATGTCAAGTTACTGAATTGCAGG - Intronic
1170172804 20:13434389-13434411 CTGTGAAGGCACAGAGTTGTGGG - Intronic
1171058802 20:21935324-21935346 ATGTAATGAGACAGAATTGTAGG + Intergenic
1171335682 20:24383407-24383429 CAGTTAAGAGACAGAAGTGTTGG - Intergenic
1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG + Intronic
1173169643 20:40713647-40713669 CTGTCAACACACAGATTTGCTGG + Intergenic
1173692784 20:44977404-44977426 GTGTGAAGATACAGATGTGTTGG + Intronic
1173718013 20:45227894-45227916 TTGCCAAGATATAGAATTCTTGG + Intergenic
1176961419 21:15163293-15163315 CTGTGAAGATACAGCATTCCAGG + Intergenic
1178025373 21:28460372-28460394 CTCCCATGACACAGAATTGTGGG - Intergenic
1180656088 22:17421969-17421991 TTGTCAGGGTACAGAATTCTAGG + Intronic
1181597478 22:23925820-23925842 CTGTCAGGAAACTGAATTGAAGG + Intergenic
1183099021 22:35572083-35572105 TTGTCAAAATACAGAATGGATGG + Intergenic
949165528 3:936388-936410 CTTTTGAGATATAGAATTGTGGG - Intergenic
949165532 3:936424-936446 CTTTTGAGATATAGAATTGTAGG - Intergenic
949165535 3:936460-936482 CTTTTGAGATATAGAATTGTGGG - Intergenic
949165539 3:936496-936518 CTTTTGAGATATAGAATTGTGGG - Intergenic
949165544 3:936532-936554 ATGTCCAGAAATAGAATTGTGGG - Intergenic
951052807 3:18113657-18113679 CTGTCAAGATACAGAATTGTGGG - Intronic
952070859 3:29634356-29634378 CTGTAAAGTTACTAAATTGTTGG - Intronic
955280124 3:57586829-57586851 CTTTCAAGAGACAGCTTTGTTGG - Intronic
956405965 3:68929397-68929419 TTGTCAAGATTCAGGATTGAGGG - Intronic
959437505 3:106334750-106334772 CAGGCAAGATAGTGAATTGTTGG - Intergenic
959933098 3:112003602-112003624 CAGTCAAGGTAGAGAATAGTAGG - Intronic
960265745 3:115619077-115619099 CTGGCAGGATACAGAAGTGGGGG - Intergenic
960512266 3:118564851-118564873 CTGGCTGGATACAGAATTCTGGG - Intergenic
962195109 3:133355015-133355037 GTGTAAAGATACAGTTTTGTGGG + Intronic
963432471 3:145227173-145227195 CTGGCAATATTCAAAATTGTAGG - Intergenic
963584131 3:147162955-147162977 CTTTCAAAATAAAGTATTGTTGG + Intergenic
964413889 3:156427673-156427695 CAATGAAGAGACAGAATTGTGGG + Intronic
967750648 3:193111854-193111876 TTGGCAAGATACAGAATCTTTGG - Intergenic
967786341 3:193501075-193501097 AAGTCAACACACAGAATTGTAGG - Intronic
969967820 4:11014871-11014893 CTTTCACAATGCAGAATTGTTGG + Intergenic
970279777 4:14442080-14442102 TTGTCAAGATAAACAATTATCGG - Intergenic
972568683 4:40291462-40291484 CCCTCAAGTTACATAATTGTAGG + Intergenic
972587646 4:40452587-40452609 CTGACAAGATACAGAACTTCAGG - Intronic
974984438 4:69003489-69003511 CTGTAAAGATACACAGTAGTGGG - Intergenic
975063536 4:70035217-70035239 CTGTTAAGAGACAGAGTTCTGGG + Intronic
975191518 4:71468653-71468675 CTGTCTAGATACAAAATATTTGG + Intronic
976552576 4:86413639-86413661 CTGTCAAGCTGCAGCATTGCAGG + Intronic
976704225 4:88005166-88005188 CTGTGAAGATTCAGAATTTCAGG + Intergenic
977077242 4:92470953-92470975 CTGTCTACATACAGTATTATTGG + Intronic
977505541 4:97898363-97898385 TTGTCCAATTACAGAATTGTTGG + Intronic
980205956 4:129719946-129719968 ATGCCAAGACACATAATTGTCGG - Intergenic
982119711 4:152130767-152130789 CTGGCTAGATACAGAATTCTGGG + Intergenic
986314637 5:6578335-6578357 CTGCCAACACACAGAATTTTAGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988708654 5:33751817-33751839 CTGTGAACCTAAAGAATTGTAGG - Intronic
989023005 5:37032105-37032127 CTGTTAAAATACAGAATGATGGG - Intronic
991168838 5:63596526-63596548 TTGGCCAGATACAGAATTCTTGG - Intergenic
993634701 5:90329959-90329981 CTGGCAGGATACAAAATTCTTGG + Intergenic
995323895 5:110869863-110869885 TTGTCTAGACAGAGAATTGTGGG + Intergenic
997650455 5:135513757-135513779 CAGTAAAGATACAGTATTATAGG - Intergenic
998580104 5:143364269-143364291 TTGGCAGGATACAGAATTCTTGG - Intronic
999609337 5:153352191-153352213 TTGTGAAAATACAGAATTCTGGG - Intergenic
1002737042 5:181401058-181401080 CTTCCAAGTTACAGAATTTTTGG + Intergenic
1002747655 6:73721-73743 CTTCCAAGTTACAGAATTTTTGG - Intergenic
1004987372 6:21097933-21097955 ATGTCAATATTCAGAATTTTTGG + Intronic
1006413649 6:33890746-33890768 ATGTTAAGATACAGAACTGTGGG - Intergenic
1007537851 6:42610736-42610758 TTTGCAAGATACAGAATTCTGGG + Intronic
1012585247 6:100913855-100913877 CTGTCAAGCTGCAGCATTGCAGG + Intergenic
1014607750 6:123498945-123498967 TTGTCAAAATACAGATTTTTGGG + Intronic
1014774792 6:125495849-125495871 ATATCAAGATGCAGAATTATTGG - Intergenic
1014870509 6:126590208-126590230 CTGGCAGGATACAAAATTCTGGG + Intergenic
1014952129 6:127568576-127568598 TTCTCTAGATACAGAATTCTGGG - Intronic
1015409222 6:132873254-132873276 CTGTCAAGTTACTGAATTGGTGG - Intergenic
1016265916 6:142232559-142232581 CTGTCAAGCTGCAGCATTGCAGG - Intergenic
1016337815 6:143026943-143026965 GTGGCAAGACACTGAATTGTAGG - Intergenic
1017969289 6:159297665-159297687 CTTTCAACCTCCAGAATTGTAGG - Intergenic
1019242138 6:170676628-170676650 CTTCCAAGTTACAGAATTTTTGG + Intergenic
1021625035 7:22584688-22584710 CTGTGAAGATTCAGAGATGTGGG + Intronic
1022608865 7:31848067-31848089 CTGTCATTATACAGAATAGCTGG + Exonic
1022950666 7:35335055-35335077 CTTTCAAGATATACAATAGTAGG + Intergenic
1023139704 7:37089765-37089787 CTGTAAAGAGACAGAATTAAGGG + Intronic
1025864691 7:65370220-65370242 CTGTGAAGTAACAGAACTGTGGG - Intergenic
1029246463 7:99205546-99205568 CAGTCAAGATACAGAGATGGGGG + Intronic
1031272470 7:119669523-119669545 CTTACTTGATACAGAATTGTAGG + Intergenic
1032779791 7:135155995-135156017 CTGGCAGGATACAAAATTCTTGG + Intronic
1033030935 7:137825857-137825879 CTATCAAGAAAGAAAATTGTGGG + Intronic
1033319642 7:140328014-140328036 CTGTGCAGACACAGAATTGGGGG + Intronic
1035505980 8:131523-131545 CTTCCAAGTTACAGAATTTTTGG - Intergenic
1037017129 8:13922768-13922790 CTGAAAAGATAAAGAATTCTAGG + Intergenic
1037735002 8:21558680-21558702 TTGCCAAGATGCAAAATTGTAGG - Intergenic
1038473053 8:27841706-27841728 CAGCCAAGAGTCAGAATTGTGGG - Intergenic
1041733081 8:61082716-61082738 CTCTCCAGACACAGAATTCTAGG - Intronic
1043412800 8:80016432-80016454 TTGTCAGGGTACAGAATTCTAGG - Intronic
1045092950 8:98765979-98766001 CTGACAAGATTTAGAATTATTGG - Intronic
1045438684 8:102189090-102189112 ATGTCAAAATACAGATCTGTGGG + Intergenic
1046213950 8:111117377-111117399 CTGTAAAGAGACATAAATGTGGG + Intergenic
1046480554 8:114811662-114811684 TTGTCTAGATAAAGATTTGTTGG - Intergenic
1047552776 8:125894680-125894702 TTGTTAAAATACAGAATTATAGG + Intergenic
1048395398 8:134009763-134009785 CTGTCAGGAAGCAGAATCGTTGG - Intergenic
1049052748 8:140211601-140211623 CTTTTAAAATAAAGAATTGTGGG - Intronic
1050389764 9:5129160-5129182 CTCTATAGATACAGAACTGTAGG - Intergenic
1050984164 9:12060762-12060784 TTGTCATGTTACAGAATTTTTGG + Intergenic
1052006164 9:23351446-23351468 ACTTGAAGATACAGAATTGTTGG + Intergenic
1052099757 9:24431252-24431274 CTGTCAAAATACAGGAGAGTTGG + Intergenic
1056245968 9:84695900-84695922 CCTTCAAGATAAAGAATTGCTGG + Intronic
1056831466 9:89920526-89920548 ATGTCAAGATACAGCCATGTTGG - Intergenic
1062713495 9:137989674-137989696 CTGTCTGGATTCAGAATTCTTGG - Intronic
1203602329 Un_KI270748v1:25850-25872 CTTCCAAGTTACAGAATTTTTGG + Intergenic
1186305049 X:8247342-8247364 CTGTGAAGATACAGAATTGCAGG + Intergenic
1188587375 X:31794031-31794053 TTTTCAAGATATAGAATTGTCGG - Intronic
1189406950 X:40733815-40733837 CCATCAAGATACTGAAATGTAGG + Intronic
1192540377 X:71964453-71964475 CTGTCAAAACACAGGATTTTGGG - Intergenic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1195370790 X:104170279-104170301 CTATCTAGATACAGAATTAGAGG + Intronic
1197829121 X:130622870-130622892 CTGGCAAGTTAGAGATTTGTAGG + Intergenic
1202240391 Y:22761047-22761069 CTGTCAAGATACACAAGACTAGG + Intergenic
1202393377 Y:24394801-24394823 CTGTCAAGATACACAAGACTAGG + Intergenic
1202477408 Y:25275299-25275321 CTGTCAAGATACACAAGACTAGG - Intergenic