ID: 951059508

View in Genome Browser
Species Human (GRCh38)
Location 3:18188716-18188738
Sequence CACCATTCTGAGATGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951059503_951059508 -8 Left 951059503 3:18188701-18188723 CCAGCCAGCCCATAGCACCATTC 0: 1
1: 0
2: 0
3: 11
4: 141
Right 951059508 3:18188716-18188738 CACCATTCTGAGATGCCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 157
951059502_951059508 22 Left 951059502 3:18188671-18188693 CCTTTATTCTTTCAGGGATAGCA 0: 1
1: 0
2: 0
3: 9
4: 197
Right 951059508 3:18188716-18188738 CACCATTCTGAGATGCCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 157
951059499_951059508 29 Left 951059499 3:18188664-18188686 CCGGCTTCCTTTATTCTTTCAGG 0: 1
1: 0
2: 5
3: 36
4: 439
Right 951059508 3:18188716-18188738 CACCATTCTGAGATGCCCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951059508 Original CRISPR CACCATTCTGAGATGCCCCA GGG Intronic
903323085 1:22554112-22554134 CTCCATGGTGAGATGGCCCAAGG + Intergenic
911430567 1:97781366-97781388 ACCATTTCTGAGATGCCCCAGGG + Intronic
911965189 1:104360010-104360032 CTTCATTCTTAGCTGCCCCATGG - Intergenic
916863465 1:168831657-168831679 CCTCATTCTCAGAAGCCCCATGG + Intergenic
917983250 1:180287759-180287781 TACTATTCTAAAATGCCCCAGGG + Intronic
918483084 1:185000708-185000730 GACATTGCTGAGATGCCCCAGGG + Intergenic
919927651 1:202200632-202200654 CACGATTCTCAGAAGCCCCCAGG - Intronic
920854416 1:209651534-209651556 CACAATTCTGGGATGCAACAGGG + Intronic
922063786 1:222116659-222116681 GCCAATTCTGAGCTGCCCCACGG - Intergenic
922543063 1:226433626-226433648 GACCATTCTGAGCTCCCTCATGG + Intergenic
923199932 1:231701464-231701486 AACCCTTCTGAGAAGCCCTAAGG - Intronic
1064417878 10:15166691-15166713 CAAAATTTAGAGATGCCCCATGG - Intronic
1067777721 10:49175424-49175446 CCCCAGGCTGAGATGCACCAGGG + Intronic
1069034045 10:63629941-63629963 TACCACTTTGAGAAGCCCCAAGG + Intergenic
1069651227 10:70051297-70051319 CATCATTATGGGATGCCCCAGGG + Intergenic
1070440560 10:76438653-76438675 CACCACTGTGAGAGGCCCCTGGG - Intronic
1070540597 10:77412637-77412659 CAGCATTGTGAGGTGCCCCAGGG + Intronic
1070891565 10:79945300-79945322 CCCCATTCTGGGATCCCCCCTGG + Intronic
1071066574 10:81643398-81643420 CACAATTGTCAGATGCACCAAGG - Intergenic
1072486066 10:95857102-95857124 CAAGATTCTGAGATGCCAGAGGG + Intronic
1072541061 10:96398250-96398272 CACCATTCTGAACTGGCCTAGGG + Intronic
1076203062 10:128573215-128573237 CACCATCCTGGGAGGCCCCAGGG - Intergenic
1076413125 10:130265775-130265797 CTCCATACTGAGTTTCCCCAAGG - Intergenic
1077909195 11:6559192-6559214 CAGCATTCTCAGATTCTCCAAGG - Exonic
1079721896 11:23825923-23825945 CACCATTCTGGCTTGCACCAAGG - Intergenic
1081687548 11:45053426-45053448 CCCCATCCTGAGGAGCCCCAGGG + Intergenic
1086432231 11:86747009-86747031 AACATTTCTGAGAAGCCCCAGGG - Intergenic
1086547639 11:88016590-88016612 CACCTTCCTGAGATGCCACAAGG + Intergenic
1088167989 11:106961170-106961192 CACCCTCCTGAAATGCCCAAAGG + Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090650601 11:128802715-128802737 CATCTTTCTGTGGTGCCCCAGGG - Intronic
1090999948 11:131902007-131902029 CACAAGGCTGTGATGCCCCAAGG + Intronic
1093747585 12:22760860-22760882 CTTCTTACTGAGATGCCCCACGG + Intergenic
1094292572 12:28868611-28868633 GACCATGCTGAGACGCCCCCAGG - Intergenic
1095494273 12:42768396-42768418 CACCACTCTCAGATGAACCACGG - Intergenic
1096023414 12:48340870-48340892 CAGTATTAGGAGATGCCCCAGGG - Exonic
1101555165 12:105802077-105802099 GACCAATCTGAGGTGCACCATGG - Intergenic
1107532884 13:41301337-41301359 CACCATTCTGCGATTCCCCCAGG - Intergenic
1107994056 13:45843326-45843348 CACCACTCTGAGATTCAGCAGGG - Intronic
1108713749 13:53058877-53058899 CACAACTCTGCGATGCCTCACGG - Intergenic
1111956979 13:94770062-94770084 CCTCTTACTGAGATGCCCCATGG - Intergenic
1114401502 14:22414831-22414853 CACCACCCTGTGGTGCCCCAGGG + Intergenic
1117718058 14:58600881-58600903 CACCATTCTGTTATGCCATAAGG - Intergenic
1118309695 14:64683262-64683284 CTCCAGTCTTAGAGGCCCCAAGG - Intergenic
1118534270 14:66742147-66742169 CAACATTCTTATATCCCCCAGGG + Intronic
1118911132 14:70063056-70063078 ATCCACTCTGAGAAGCCCCATGG + Intronic
1118918799 14:70131190-70131212 CTCCATTCTGAGATCATCCAAGG - Intronic
1119144103 14:72294636-72294658 CACCATTCTAAGTTTTCCCAAGG - Intronic
1121234384 14:92381416-92381438 CACCGTCCTGACAGGCCCCAGGG - Intronic
1121805483 14:96816538-96816560 CCTCTTACTGAGATGCCCCATGG + Intronic
1122078064 14:99248202-99248224 CTCCTTTCTGAGACACCCCAGGG + Intronic
1122352599 14:101104646-101104668 CCACATTCTCAGAGGCCCCATGG - Intergenic
1122800142 14:104225306-104225328 CTTCACTCTGAGCTGCCCCAGGG - Intergenic
1122800209 14:104225586-104225608 CTTCACTCTGAGCTGCCCCAGGG - Intergenic
1123044010 14:105502749-105502771 TGCCATTCTGAGGGGCCCCATGG + Intergenic
1125119097 15:36131822-36131844 CATCATTCTCAGAGGCCCAAGGG + Intergenic
1125360145 15:38856568-38856590 CAACCTTCTGAGATGTCCCTTGG - Intergenic
1128721629 15:69954708-69954730 CCCCATGAGGAGATGCCCCAGGG - Intergenic
1129603079 15:77011627-77011649 CAGCTGTCTGAGATGGCCCAGGG - Intronic
1130033259 15:80334704-80334726 TACCCTTCTGAGAAGGCCCATGG + Intergenic
1130420054 15:83736586-83736608 AGCCATTCTGAGAAGTCCCAAGG + Intronic
1132898141 16:2238500-2238522 CACCCTTCAGTGAGGCCCCAAGG + Exonic
1133599399 16:7324443-7324465 CCCCCTTCTGAGAGGCCTCAGGG + Intronic
1134029219 16:10978372-10978394 CACCATGCAGAGGTGCTCCAAGG + Intronic
1135046020 16:19156447-19156469 CACCCCTCTGAAATCCCCCATGG - Intronic
1136100813 16:27994294-27994316 CACCATTCTGAACCCCCCCAAGG - Intronic
1136173878 16:28504530-28504552 CACCATGCGGAGATGCCATATGG - Intronic
1140200464 16:72890602-72890624 CAACATTCTGAAAAGCCACATGG - Intronic
1141659267 16:85433062-85433084 CCCCATTCCAAGTTGCCCCAGGG - Intergenic
1142103049 16:88285722-88285744 CACCACTCAGAGAGGGCCCAGGG - Intergenic
1143464809 17:7129547-7129569 CACCAGTCTGAGAGGCCCAGAGG + Intergenic
1144083270 17:11783839-11783861 TACCATTCTGAGAGGCTGCATGG - Intronic
1145266292 17:21381075-21381097 CCCCTTTCTCAGCTGCCCCAGGG + Intronic
1146792464 17:35760068-35760090 CACCAAACTTAGATGCCCAAAGG + Intronic
1148345155 17:46898188-46898210 GACCTTGCTGAGATACCCCAAGG + Intergenic
1149008539 17:51831062-51831084 CACTATTCTGAGATTCATCACGG + Intronic
1149517739 17:57293176-57293198 CACCATTCTCAGTTCACCCAGGG - Intronic
1152422524 17:80201808-80201830 CACCCTCCTGAGAAGCCCCACGG - Exonic
1153842351 18:9018037-9018059 AACCATACTAAGATGTCCCAGGG + Intergenic
1157044412 18:44082022-44082044 CACCATTTTCAGTTGTCCCACGG - Intergenic
1157481705 18:48059504-48059526 CAGCATTCTCAAATGTCCCATGG + Intronic
1157682741 18:49619604-49619626 CACCACTCAGAGATGGCCCCAGG - Intergenic
1158674026 18:59502183-59502205 CACCTTGCTGAGCTGCCCAAGGG + Intronic
1158855495 18:61539768-61539790 CAGCATTCTGAGATAGGCCAGGG - Intronic
1161378764 19:3953541-3953563 GACCTTTCTCTGATGCCCCAGGG + Intergenic
1164533952 19:29070424-29070446 CACCTTTCTTAGCTGCCCCATGG - Intergenic
1167875158 19:52406068-52406090 CACAATTCAGAGATCCACCAGGG - Intronic
1168019199 19:53596284-53596306 CACCATGCTGGGATTCACCAGGG - Intergenic
926115513 2:10210567-10210589 CACCATTCTCAGACCCCCCAGGG + Exonic
927295182 2:21445410-21445432 CCCAAGTCTGAGAAGCCCCAAGG - Intergenic
928849899 2:35733505-35733527 GACCATTTTGATATGCACCAAGG + Intergenic
932924043 2:75950293-75950315 CACCATTATGAGATGACCCAAGG - Intergenic
938748905 2:134309689-134309711 CTCCATTCTGATAAGCCCCACGG - Intronic
938857206 2:135325739-135325761 CACCATTCTGCAATGTCCAAAGG + Intronic
939518514 2:143200154-143200176 CTCCTTTCTGAAATTCCCCATGG + Intronic
948708434 2:239810294-239810316 CAACATGCTCACATGCCCCAGGG + Intergenic
948905020 2:240975681-240975703 CTGGATTCTGAGATGCCCCCAGG - Intronic
1169300577 20:4438822-4438844 GACCATCCTTGGATGCCCCATGG - Intergenic
1169926139 20:10786277-10786299 CACCCTTCTGGCATGCCTCAGGG - Intergenic
1171236747 20:23533392-23533414 CAGAATTCTAAGATGCCCCCAGG - Intergenic
1172242928 20:33425331-33425353 CTCCACACTGAGAAGCCCCAGGG - Intronic
1173941976 20:46918745-46918767 CACCATTCTAAGATGCCATTAGG - Intronic
1174101480 20:48129498-48129520 CCCCTTACTGAGATGCCCCCAGG + Intergenic
1174537233 20:51260619-51260641 CACCTTCCTGCCATGCCCCAGGG - Intergenic
1175956144 20:62610382-62610404 CGCCAGTCTGAGCTGCCCCCTGG + Intergenic
1178572662 21:33754633-33754655 CACAATCCTGAGCTGGCCCAAGG - Intronic
1179380029 21:40889816-40889838 TACCCCTCTGAAATGCCCCATGG + Intergenic
1183279637 22:36924935-36924957 CACCTTTGGGAGATGCCCCAGGG - Intronic
1183973987 22:41499649-41499671 CACCATACTGAGCTGCCCTCGGG + Intronic
1184814855 22:46861709-46861731 CACAATTCTGAGTTTGCCCATGG - Intronic
950022944 3:9801464-9801486 CGTCATTAAGAGATGCCCCAAGG + Intronic
950149873 3:10678591-10678613 CACTTTTCTGAGAGGCCCCCAGG - Intronic
951059508 3:18188716-18188738 CACCATTCTGAGATGCCCCAGGG + Intronic
953019171 3:39103166-39103188 CCCCACTCTGAGCTGCCCCTTGG + Intronic
953674631 3:44991284-44991306 CACCAGCCTGAGTTGTCCCATGG + Intronic
961530335 3:127536558-127536580 CACCAGGCTGAGATGCCCAAGGG - Intergenic
961558009 3:127709933-127709955 CACTATTCTGAGTTACCCCCAGG + Intronic
962373404 3:134839947-134839969 CCTCATTGTGGGATGCCCCAGGG - Intronic
976617611 4:87094264-87094286 AACCATTCTGTGATTTCCCAGGG + Intronic
978906445 4:114011595-114011617 CACCATTGTCAGATTCACCAAGG - Intergenic
980129254 4:128803286-128803308 CACCCTCCTGACATGCCCCAGGG + Intergenic
982713105 4:158778443-158778465 CACCATTCTGAGTAGCACAATGG + Intronic
983425347 4:167576966-167576988 TATCAATCTGAGATGCCCAAAGG - Intergenic
983869581 4:172809566-172809588 CACCATCCTGGGATGCCTCAGGG + Intronic
985486575 5:155144-155166 CGGCATTCTCAGATGCACCACGG - Intronic
985733797 5:1565870-1565892 CACCAGGCTGACATGCCCCTAGG - Intergenic
987382232 5:17295853-17295875 CAACATCCTGAGATGAGCCACGG + Intergenic
989177780 5:38545434-38545456 CACCATTCAGAGATAACCCCAGG - Intronic
989288292 5:39730110-39730132 CATCATTGTGAGAAGCCACATGG - Intergenic
989470801 5:41815723-41815745 CACCATTATCATATACCCCAAGG + Intronic
992208689 5:74456060-74456082 CTCCATGCTCAGATGCCACAAGG + Intergenic
994191133 5:96870580-96870602 TCTCTTTCTGAGATGCCCCAGGG + Intronic
996230862 5:121061666-121061688 CACCATTCCTAGATGAACCAAGG + Intergenic
997442660 5:133919538-133919560 CACCATTCTGATTTCCCCCATGG + Intergenic
999499493 5:152132492-152132514 CAGCATTCTGAGCTGCACCTGGG + Intergenic
999945778 5:156593677-156593699 CTTCTTTCTGAGATGCCCTATGG + Intronic
1000506012 5:162119010-162119032 CAGCATTCTCAAATGCCCCTGGG - Intronic
1001340269 5:170837090-170837112 CAGCATTCTGGGAGCCCCCAGGG + Intergenic
1003890768 6:10562060-10562082 CACACATCTGAGATGCCCAAGGG + Intronic
1004083834 6:12424101-12424123 CATGAGTCTTAGATGCCCCATGG + Intergenic
1005411347 6:25550753-25550775 AAGAATTCTGAGCTGCCCCAGGG - Intronic
1006827709 6:36948346-36948368 CACAGTTCTCAGATGCCCCCCGG - Intronic
1006915257 6:37589797-37589819 CACAATTCAGAGAGGCCCAAAGG + Intergenic
1016359211 6:143250044-143250066 CACCATGCTTAGAGGCCCCATGG - Intronic
1016570004 6:145501310-145501332 CAACATTCTGTGATGCCACCAGG - Intergenic
1017628624 6:156373967-156373989 GACAATTTTGAGATGACCCAAGG - Intergenic
1020333576 7:7043835-7043857 CATAATTGTGAGATTCCCCAAGG + Intergenic
1020399732 7:7761796-7761818 CAACATTCTCAGATGTCACAAGG - Intronic
1029557299 7:101279278-101279300 CACCCCTGTGAGTTGCCCCAAGG - Intergenic
1031735404 7:125353479-125353501 CATCTTTCTGAGATGCCTCATGG - Intergenic
1031876786 7:127150797-127150819 CACCATTCTCAGCTGACCCTTGG + Intronic
1036012958 8:4748572-4748594 CAGCATTCTGAGAAGACTCACGG + Intronic
1039329056 8:36516313-36516335 CATCAATCTGAGATGCCGGATGG - Intergenic
1040951834 8:52945145-52945167 CCCCATTCTGAGGTAACCCAAGG + Intergenic
1041378952 8:57231916-57231938 CACCATTCTGATTTTACCCAGGG + Intergenic
1045595970 8:103656984-103657006 AACCATTCTGAAATAGCCCAGGG + Intronic
1046897427 8:119487926-119487948 CAACACTCTGAGATGCAACAGGG - Intergenic
1047311637 8:123697291-123697313 CACCCTTCTCAGAAGCACCAAGG - Intronic
1048556942 8:135487723-135487745 CACCATTGTGAAATCCACCATGG - Intronic
1049659312 8:143812643-143812665 CAGCCTTCTGGGCTGCCCCAGGG + Intronic
1050310121 9:4344207-4344229 CACCATTTTTATTTGCCCCAGGG + Intronic
1051221585 9:14853750-14853772 AACGATACTGAGATGTCCCAGGG + Intronic
1053598280 9:39585442-39585464 CTGGCTTCTGAGATGCCCCAGGG - Intergenic
1056910463 9:90695829-90695851 GACGAGTCTGAGATGCCCGAGGG - Intergenic
1057047509 9:91897681-91897703 CCCCTTTGTGAGATGCCCCTGGG - Intronic
1057697835 9:97339609-97339631 CACAATTGTCAGATGCACCAAGG - Intronic
1060203769 9:121669452-121669474 ACACTTTCTGAGATGCCCCATGG - Intronic
1060477287 9:123996407-123996429 CACCATTTTGAGAGGCAGCAAGG - Intergenic
1060791585 9:126489081-126489103 CAGCATCCTGAGGAGCCCCAGGG + Intronic
1061873815 9:133534333-133534355 CCCCATTCTCAGGAGCCCCAGGG + Intronic
1187098442 X:16169491-16169513 CTCCATTCTGAAATACCCCTAGG - Intronic
1187506684 X:19883993-19884015 CATCTTACTGAGATGCCCCGCGG + Intronic
1189957351 X:46288911-46288933 CCCCACCCTGAAATGCCCCATGG - Intergenic
1196050394 X:111298159-111298181 AACCATTATGAGATGACACAAGG + Exonic
1198081438 X:133243773-133243795 CACCCTTCTTAGCTGTCCCAAGG - Intergenic