ID: 951059547

View in Genome Browser
Species Human (GRCh38)
Location 3:18189096-18189118
Sequence TCTAAGCTTTAAAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951059547_951059552 -7 Left 951059547 3:18189096-18189118 CCTCCCACCTTTTAAAGCTTAGA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 951059552 3:18189112-18189134 GCTTAGAGATCTAGAGCCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
951059547_951059551 -10 Left 951059547 3:18189096-18189118 CCTCCCACCTTTTAAAGCTTAGA 0: 1
1: 0
2: 1
3: 22
4: 151
Right 951059551 3:18189109-18189131 AAAGCTTAGAGATCTAGAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951059547 Original CRISPR TCTAAGCTTTAAAAGGTGGG AGG (reversed) Intronic
902310080 1:15575441-15575463 TCTAAGATCTTAAAGGAGGGTGG - Intronic
902519397 1:17007456-17007478 ACTAAGCTGGAAAAGCTGGGCGG + Intronic
908950510 1:69557092-69557114 TCTAACCTAAGAAAGGTGGGAGG + Intergenic
909245470 1:73276420-73276442 TATAATTTTTGAAAGGTGGGTGG + Intergenic
910425343 1:87115388-87115410 TCTAACCTTTTCAGGGTGGGAGG + Intronic
915606118 1:156952281-156952303 TCTTAGCTTTGAAAGGGGGCTGG - Intronic
920785123 1:209033943-209033965 TCTTATCTTTTAAAGGTGTGTGG - Intergenic
921854649 1:219968755-219968777 TCAATGCTTTAAAAAGTGAGAGG + Exonic
921935381 1:220790956-220790978 TAAAATTTTTAAAAGGTGGGGGG + Intronic
923332906 1:232942203-232942225 TGGAAGTATTAAAAGGTGGGTGG + Intergenic
924209812 1:241753104-241753126 TCAAAGCTTTAAAAAATGGAAGG + Intronic
924298438 1:242612445-242612467 TCTAAGCTTTTAAAGGACGTGGG - Intergenic
1063611923 10:7570058-7570080 ACTAAGCTTTGAGAGGTGAGAGG + Intronic
1068804214 10:61176493-61176515 ACTCCGTTTTAAAAGGTGGGTGG - Intergenic
1069064825 10:63931344-63931366 TTTAAGATATACAAGGTGGGAGG + Intergenic
1069816829 10:71201886-71201908 TCTAAACTCTAAAAGGGAGGAGG - Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072318248 10:94224009-94224031 TATAAGCATTAAATGGTGAGAGG - Intronic
1072402601 10:95121241-95121263 AGTAGGCTTTAGAAGGTGGGTGG - Intergenic
1074246890 10:111703358-111703380 ACTGAACCTTAAAAGGTGGGTGG - Intergenic
1078447379 11:11414522-11414544 TCTGAGCTTTAAAGGATGGAAGG - Intronic
1079086189 11:17446834-17446856 TCTAAGCTTTACAAGTAAGGAGG + Intronic
1081854650 11:46295790-46295812 TCTAAAATTTAAAGGGCGGGCGG + Intronic
1085225267 11:74914280-74914302 TCTAAAATTTAAAAGGGGGATGG - Intronic
1085367419 11:75963178-75963200 TCTAAGCTCTATAAGGCGAGGGG + Intronic
1085625145 11:78066166-78066188 TCAAAATTTAAAAAGGTGGGGGG - Intronic
1087613683 11:100464257-100464279 TCTAGGGTTTAAAAGATGGATGG - Intergenic
1088981565 11:114868779-114868801 TCCATACTTCAAAAGGTGGGTGG - Intergenic
1091542756 12:1477341-1477363 CTTTAGCTTTAAAAGGGGGGAGG - Intronic
1092593211 12:9970646-9970668 GCTAAGCTATCAAAAGTGGGAGG - Intronic
1095218357 12:39577487-39577509 TCAAAGGTATAAAAGGTAGGTGG + Intronic
1098280495 12:68857458-68857480 TCAAAGCTTTTAAAGGAGGGTGG - Intronic
1100389300 12:94133681-94133703 TCAACACTTTAAAAGGTAGGAGG + Intergenic
1100680249 12:96910906-96910928 TCAAAGCTTTAAAATGTGACTGG + Intronic
1101350166 12:103922547-103922569 TCTAAGCTTTAAAAAAAAGGTGG + Intergenic
1101587605 12:106098679-106098701 TATAAAATTGAAAAGGTGGGTGG - Intronic
1101888055 12:108686416-108686438 TCTAAGCTTTAGAAGATTGGTGG - Intronic
1104374987 12:128257748-128257770 TCTCATCCTTACAAGGTGGGAGG + Intergenic
1104463998 12:128975854-128975876 TCTGTGTTTTAAGAGGTGGGTGG + Intronic
1104828198 12:131729978-131730000 TCTCAGCTTTAAAAGGTTTTTGG - Intronic
1106892168 13:34257405-34257427 TGTAAGCTTTGTGAGGTGGGTGG + Intergenic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1108456215 13:50616594-50616616 TATAAACTTTAAAAGGTTTGGGG + Intronic
1109893513 13:68651588-68651610 TCAAAGCTTTAAAAGACAGGTGG + Intergenic
1111720666 13:91939956-91939978 TGTAAGCATTAAAAGATGGGAGG - Intronic
1112931749 13:104748660-104748682 TGTAAGCTTTAGAAACTGGGCGG - Intergenic
1113304062 13:109057685-109057707 TCTACACTTAAGAAGGTGGGAGG - Intronic
1114179512 14:20353822-20353844 TCTGAGTTGTAAAATGTGGGAGG + Intronic
1115271201 14:31555442-31555464 TCTAAGAATTGAAAGGTGGGAGG + Intronic
1115451714 14:33555593-33555615 TATCAACTTAAAAAGGTGGGAGG - Intronic
1120807653 14:88770366-88770388 TATAAAATTTAAAAGGTGAGAGG - Intronic
1121224987 14:92315135-92315157 TCTAACCTGTGAAATGTGGGTGG + Intergenic
1124009230 15:25822754-25822776 TATAAGGTATAAAAGGTGAGGGG - Intronic
1125260964 15:37824200-37824222 TCTCAGCCTTAAAAGATGAGTGG + Intergenic
1125375142 15:39020893-39020915 TCTAAGTCTTAAAAGATTGGTGG - Intergenic
1129611949 15:77067628-77067650 TCAAGGCATTAAAAGGAGGGAGG + Intronic
1129709482 15:77813258-77813280 GCTAAGCCTTAAAAAGTGGGTGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131185741 15:90272501-90272523 TATAAACTTTAAAATGTGGCTGG - Exonic
1132541821 16:513686-513708 TCTTAGCTTTAAGAGCTGGAAGG - Intronic
1133017532 16:2951221-2951243 TCTAAGTTTGAAAATGGGGGTGG + Intergenic
1133230855 16:4365867-4365889 TCTAGGCTGTCGAAGGTGGGAGG - Intronic
1133713954 16:8429024-8429046 TCTAACCTCTAAAATGTGGCTGG - Intergenic
1134354077 16:13464830-13464852 TCTGAACTGTAAAAGGTGGGGGG - Intergenic
1139749511 16:69100806-69100828 TCAAAGCTTTAGCAGGTTGGAGG - Intergenic
1140077738 16:71717850-71717872 TCTAAGATTTAGAAGGTCAGTGG - Intronic
1140441477 16:74991346-74991368 CCTAAACTCGAAAAGGTGGGGGG + Intronic
1141770651 16:86087816-86087838 TCCAAGCTTTAAACGTTGGCTGG + Intergenic
1144348619 17:14372882-14372904 TCTAAGCTTGGAAGGGAGGGCGG - Intergenic
1157553183 18:48595211-48595233 TCTAGGATTTTAAAGGTGGCAGG + Intronic
1158509966 18:58081521-58081543 TCTCTGCTTTAAAAAATGGGTGG - Intronic
1159208002 18:65279113-65279135 CCTAAACTTTAAAAGGAAGGCGG + Intergenic
1159518578 18:69489179-69489201 TTTAAGCTGGACAAGGTGGGTGG - Intronic
1160762815 19:794157-794179 TCTAAGCTTCAGGTGGTGGGTGG + Intergenic
1163086392 19:14983376-14983398 TCTAAGCTCTAGAAGGTTGTGGG + Intronic
1164843440 19:31412087-31412109 GCTAAGCTTTAATAGGTTGTTGG + Intergenic
924980119 2:211892-211914 TGAAAGCTTTAAAAGTTGTGTGG + Intergenic
925534383 2:4900823-4900845 TATAACCTTAAAAAGGTAGGTGG + Intergenic
926000422 2:9327137-9327159 TCTCAGCTGTAAAGGATGGGCGG - Intronic
929840887 2:45461661-45461683 TCTGAGATTTAAAAGTTGGGGGG - Intronic
932819902 2:74890780-74890802 GCAAAGCTGGAAAAGGTGGGAGG - Exonic
938988851 2:136607270-136607292 GTTCAGCTTTAAAAGATGGGTGG + Intergenic
941630660 2:167880530-167880552 TCTAACCTTTAAAACCAGGGAGG - Intergenic
941708418 2:168685206-168685228 TCAAAGATGTAAAAGGTGTGTGG - Intronic
946183315 2:217961899-217961921 GCTAACCTTGAAAAGGTGGGTGG + Intronic
947489112 2:230578748-230578770 TCTAAGCTTTCCCAGGTTGGTGG - Intergenic
948953080 2:241267570-241267592 TGTAAGCATTAAGAGGTGTGTGG - Intronic
1170529782 20:17279505-17279527 GCAAAGCTTTAAAATGTGTGTGG + Intronic
1174971811 20:55284634-55284656 TCTAAGCTTTAAATGGTATATGG + Intergenic
1175365414 20:58451418-58451440 TTCCAGCTTTGAAAGGTGGGTGG + Intergenic
1177214410 21:18109846-18109868 TCTAAGCATAAAAAGGTTAGAGG + Intronic
1178435311 21:32553019-32553041 TGTAAGCTTGAGAAGCTGGGGGG + Intergenic
1180034624 21:45238340-45238362 TCAAAACATTAAAAAGTGGGAGG + Intergenic
1183812192 22:40266599-40266621 GCCTAGCTTCAAAAGGTGGGTGG + Exonic
949190448 3:1243696-1243718 TTTACTCTTTAAAAGGTGGCTGG - Intronic
949331684 3:2930571-2930593 TCTAATATTTAAAAGGGTGGGGG - Intronic
950689522 3:14644594-14644616 ATTCAGCCTTAAAAGGTGGGGGG + Intergenic
951059547 3:18189096-18189118 TCTAAGCTTTAAAAGGTGGGAGG - Intronic
953644611 3:44742491-44742513 TCTGACCTTTACAAAGTGGGAGG + Intronic
953767937 3:45758451-45758473 CCTAAGATTTAAAGGGTGGAAGG + Exonic
956408835 3:68957494-68957516 TCCAAGAATTAAGAGGTGGGAGG + Intergenic
957160835 3:76607873-76607895 TCTAAGCTATACAGTGTGGGTGG - Intronic
957546953 3:81651461-81651483 GATTAGCTTTAATAGGTGGGAGG - Intronic
961256114 3:125554487-125554509 TTTAAGCTTTAACACGTAGGTGG - Intronic
963360925 3:144271067-144271089 TCCAAGGTTTAAAATGTGGAGGG - Intergenic
964251114 3:154718878-154718900 TTTGTGCTTTAAAAAGTGGGTGG - Intergenic
964435342 3:156645522-156645544 TCTCAAATGTAAAAGGTGGGAGG - Intergenic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
967740028 3:192994685-192994707 GCTAAGCTGAATAAGGTGGGAGG - Intergenic
970145674 4:13033033-13033055 GCTGGGCTTTAAAAGGTGGGTGG + Intergenic
972787891 4:42344623-42344645 GATAAGTTTTCAAAGGTGGGGGG + Intergenic
973018063 4:45166280-45166302 TCTAAGGATTAAGATGTGGGTGG + Intergenic
975809707 4:78154484-78154506 TAATAGCTTTAAAAGGTGGGTGG - Intronic
977212796 4:94240891-94240913 GCTCTGCTTTAAAAGGTGGTGGG + Exonic
977432240 4:96944762-96944784 TCTAAGTTTTCCAAGGTGGGAGG + Intergenic
978438563 4:108710849-108710871 TTTACTCTTTAAAAGGTGGCTGG + Intergenic
980342095 4:131563895-131563917 TCTAAGCTTTAGAACGTTGTAGG - Intergenic
983044053 4:162964834-162964856 TCTAAGATTTAAAAAATGGTAGG - Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
987177446 5:15329336-15329358 TGTAAACTGTAAAAGGTTGGAGG + Intergenic
988678684 5:33461500-33461522 TATAAGCTTTAAAAAGGGGTTGG + Intronic
989102503 5:37835548-37835570 TCATAACTTTAAGAGGTGGGAGG - Intronic
989610116 5:43282693-43282715 TCTTAGTGTTAAGAGGTGGGAGG + Intergenic
990150525 5:52812354-52812376 TATAAGCTTCAAGAAGTGGGTGG - Intronic
990322438 5:54643079-54643101 TCTAAACTATAAAGGGAGGGGGG + Intergenic
991979610 5:72217630-72217652 CCTAAGCTTTGAAAGGAGGGAGG + Intergenic
992454368 5:76902740-76902762 TCTAAAATTAAAATGGTGGGGGG - Intronic
993289833 5:86052906-86052928 ACTAAGCTTTAAAAGCTGGTGGG + Intergenic
995908965 5:117162618-117162640 TCTAAGCTTTAAAACGTTTTAGG + Intergenic
996554689 5:124766236-124766258 TCTAAGCTATAAAAGTTAGCTGG + Intergenic
996643294 5:125784834-125784856 ACAATGCTATAAAAGGTGGGAGG - Intergenic
999928399 5:156404552-156404574 TTTGAGATTTAAAAGGTAGGAGG - Intronic
1002589733 5:180282062-180282084 TCTAAGCTATAGGAGGTGCGAGG + Intronic
1002911727 6:1495966-1495988 ACTCAGCTTTAAAAGGTGCAGGG - Intergenic
1004254871 6:14054165-14054187 TCTATACTTTAAAAGGTGACAGG - Intergenic
1006710810 6:36068697-36068719 TCTGTGCTTTAAAAAGTGGGAGG + Intronic
1008720216 6:54339870-54339892 TCCAAGCTTAAATGGGTGGGGGG + Intronic
1009497135 6:64364737-64364759 TGGAAACTTTAAAAGGTGGGTGG + Intronic
1012378833 6:98595218-98595240 TCTAAGCTTGAAAGGGTGTGAGG + Intergenic
1015288090 6:131508170-131508192 TTTACTCTTTAAAAGGTGGCTGG - Intergenic
1016110156 6:140213111-140213133 TCTAAACTTTCAAAGCAGGGTGG - Intergenic
1016251290 6:142046028-142046050 TGTCAGCTGTAAAGGGTGGGAGG - Intergenic
1022285503 7:28953491-28953513 TCTATGGCTGAAAAGGTGGGTGG + Exonic
1023282276 7:38583434-38583456 TTTAAGTATTAAAAGGTGTGTGG - Intronic
1023637933 7:42231289-42231311 TCAAAAGTTTAAAAGTTGGGAGG - Intronic
1024569249 7:50710322-50710344 CCTGGGCTTTGAAAGGTGGGTGG - Intronic
1026453472 7:70550400-70550422 ACTAAGCTTTGAAGGATGGGGGG + Intronic
1027603858 7:80275025-80275047 TCTAATTTTTAAAAGGGGGGAGG - Intergenic
1031356050 7:120788438-120788460 TCTATGCTTTAAAATGAGGATGG - Exonic
1031797388 7:126193293-126193315 TTTAAGTTTTAAAAGGTGAGTGG + Intergenic
1032572673 7:133016937-133016959 TTTCTGTTTTAAAAGGTGGGTGG - Intronic
1034743366 7:153498991-153499013 TCAAAGCTTTAAAAGGCAGGCGG + Intergenic
1036598024 8:10231505-10231527 TTTAAGCTTTCTCAGGTGGGTGG + Intronic
1038662400 8:29508428-29508450 TTTAAGCTTTAAAAAGGGGGAGG - Intergenic
1041245345 8:55883804-55883826 TATCAGCCTTAAAAGATGGGAGG - Intronic
1042344160 8:67710625-67710647 TCTAAACTTCAAAAGGGAGGGGG + Intronic
1045052495 8:98339900-98339922 TCTAAGTAATGAAAGGTGGGTGG + Intergenic
1045080973 8:98625530-98625552 TGGAAGTTTTAATAGGTGGGAGG - Intronic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1046906715 8:119581611-119581633 TCTAAGGTTTAAAGGGTGAGGGG - Intronic
1047859621 8:128950899-128950921 TCTCACCTTTCAAAGGTGAGAGG + Intergenic
1049956189 9:695349-695371 AATATGCTTTAAAAGTTGGGGGG + Intronic
1050115725 9:2261224-2261246 TCTAACCTTTGAAGGGTCGGGGG + Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1058877332 9:109255913-109255935 TCTAAGCTTTAAAAGTAGAAAGG - Intronic
1059220162 9:112608203-112608225 TCTAATTGTTAAAAGTTGGGAGG + Intronic
1060448681 9:123716400-123716422 TCAAAGCTTTAAAAGGACGAAGG + Intronic
1061535315 9:131244582-131244604 TCTAAGTCATAAAATGTGGGCGG + Intergenic
1186190449 X:7062677-7062699 TCTGTGCTTTACGAGGTGGGTGG + Intronic
1187979651 X:24742163-24742185 TCTAGGTATTAAAAGGGGGGGGG - Intronic
1193427224 X:81354782-81354804 TCTAAGTTTTCAAAGGTGGGAGG - Intergenic
1193718329 X:84958065-84958087 TCAGATCTTTAAAAGGTGGTAGG + Intergenic
1196098119 X:111821346-111821368 TCTAAGAGTGAAAATGTGGGAGG - Intronic
1200984176 Y:9288680-9288702 TGTAAGCTTTAAAAGCTGCAGGG - Intergenic