ID: 951064289

View in Genome Browser
Species Human (GRCh38)
Location 3:18246413-18246435
Sequence CTGTGTAAGCAGAACAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951064289 Original CRISPR CTGTGTAAGCAGAACAAGAG AGG (reversed) Intronic
901661706 1:10802216-10802238 CTGGGGAGGGAGAACAAGAGGGG + Intergenic
902279008 1:15360833-15360855 TTGTGTAACAAGAACAAAAGGGG - Intronic
904623063 1:31787131-31787153 CTGTGCAAGCAGAAGCCGAGAGG - Intergenic
904797426 1:33067544-33067566 GTTTGTAAGGAGAAAAAGAGAGG - Intronic
906940158 1:50248842-50248864 CTGTGTAAGGAGACCAGAAGAGG - Intergenic
910836290 1:91516069-91516091 CTGTTTAAACAAAAAAAGAGAGG - Intronic
913353476 1:117890098-117890120 CTTTGTAATAAGAACAAGACAGG + Intronic
914237817 1:145828139-145828161 CATTGTAAGCAAAGCAAGAGAGG + Intronic
918184187 1:182112666-182112688 CAGGGTGAGCAAAACAAGAGAGG + Intergenic
919270230 1:195332246-195332268 CTGTGGAAGAAGAAAAAAAGTGG + Intergenic
919863817 1:201763495-201763517 CTGTGAAAGAAGTACAGGAGGGG + Intronic
920127575 1:203705717-203705739 CTCTGTAAGAAGAACAAGGCAGG - Intronic
920415591 1:205797302-205797324 CTGAGTGGGCAGAACAACAGAGG - Intronic
920748702 1:208653536-208653558 CTGAGTAATAAGAACACGAGTGG - Intergenic
922493897 1:226040885-226040907 GGGTGTAAGCAGAACAGGACAGG - Intergenic
923519112 1:234722417-234722439 GTGTGTGAGCAGATCAGGAGAGG - Intergenic
924219046 1:241854635-241854657 CTGTGTAGTCAGGAGAAGAGAGG + Intronic
1063232282 10:4076952-4076974 ATATGGAAGCAGAACAAGACAGG - Intergenic
1070942296 10:80357983-80358005 CTGTGTAAGCAGACCCTCAGAGG + Intronic
1073189976 10:101644230-101644252 CTGTGCAAGCCAAACAAAAGAGG + Intronic
1073773734 10:106763472-106763494 CTCAGTAAGCTGAATAAGAGAGG - Intronic
1073961779 10:108939459-108939481 CTGTGTAATGAGAACATGACTGG + Intergenic
1075501897 10:122982429-122982451 CTGTGTAAGCACTGCTAGAGTGG + Intronic
1080111534 11:28573529-28573551 CTGTCTAAACAGCAAAAGAGTGG + Intergenic
1080176879 11:29374274-29374296 CTGTGTAAGCTGAAGAACAGTGG - Intergenic
1083717215 11:64584319-64584341 CTGTGTTGGGAGGACAAGAGGGG - Intergenic
1084622935 11:70286022-70286044 TTGTGTAGGCAGAACTAGGGAGG + Intronic
1089462885 11:118663023-118663045 CTCTGGAAGGGGAACAAGAGAGG - Intronic
1089553764 11:119302910-119302932 CTGTATAAGAAGAGAAAGAGAGG - Exonic
1091326247 11:134690321-134690343 CTGTGTAAGGCCAAGAAGAGCGG + Intergenic
1091580694 12:1786858-1786880 CAGTGGAAGCAGCACATGAGTGG + Exonic
1092159223 12:6306847-6306869 CTTAGTAGGGAGAACAAGAGTGG + Intergenic
1092284030 12:7118492-7118514 CTCTGTACACAGAACAACAGCGG - Intergenic
1092504034 12:9076937-9076959 CTGTGAAGGCAGAACAAGAAGGG + Intronic
1093213271 12:16332817-16332839 CTCTGTAAGCAGGACATGGGTGG - Intergenic
1094363508 12:29655668-29655690 CAGTGTAAGCAGAAAATGACAGG + Intronic
1097040832 12:56154956-56154978 CTATGTGAACAGAACAAGGGAGG - Intronic
1098845624 12:75531667-75531689 CTATGTATGCAAAAGAAGAGTGG - Intergenic
1099065235 12:77968853-77968875 TTGTCCAAGCAAAACAAGAGTGG - Intronic
1099298278 12:80858563-80858585 CTGTGTAACAAGGACAAGACAGG - Intronic
1099616743 12:84945220-84945242 ATGTGGAGGCAGAACATGAGAGG - Intergenic
1101273039 12:103168176-103168198 TGGTGTAAGCAGAAGAAAAGTGG - Exonic
1103157694 12:118700556-118700578 CTTTTCAAGCAGAAAAAGAGAGG - Intergenic
1105567889 13:21569392-21569414 CTCTATAAGCAGAGCATGAGAGG - Intronic
1107675009 13:42786577-42786599 CTGTTTAAGCAAATGAAGAGAGG + Intronic
1108172450 13:47755776-47755798 CTGGGTCACCAGAACTAGAGTGG + Intergenic
1108991873 13:56668786-56668808 CTTTGGAGTCAGAACAAGAGAGG + Intergenic
1110843649 13:80170216-80170238 CTGGGGAAAGAGAACAAGAGAGG + Intergenic
1111922962 13:94431595-94431617 GTGTGTAAATGGAACAAGAGGGG + Intergenic
1114601031 14:23955531-23955553 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114605242 14:23990678-23990700 CTCTATAAGCTGAAGAAGAGGGG - Intronic
1114610715 14:24038310-24038332 CTCTGTAAGCTGAAGAAGAGGGG - Intergenic
1114728220 14:24962086-24962108 CTGTGTTTGCAGAGAAAGAGAGG - Intronic
1114898988 14:27032772-27032794 CACTGTAGGCAGAACAAGAGTGG - Intergenic
1116737239 14:48707552-48707574 CTCTCCAAGTAGAACAAGAGAGG + Intergenic
1117779898 14:59221730-59221752 CTGAGTCAGCAGGACAAGAAAGG - Intronic
1118347332 14:64949904-64949926 CTGGGTAAGAAGGACAGGAGTGG + Intronic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1124715661 15:32058733-32058755 CTGTGGGGGCAGAACTAGAGTGG + Intronic
1127791477 15:62402453-62402475 CTGGGTAAGGAGGACAAGAAAGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129555910 15:76509258-76509280 GTGTGAAAGCTGAAGAAGAGGGG - Intronic
1130026853 15:80277555-80277577 CTGGGTTAGAAGAACAAGAGTGG - Intergenic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1135221425 16:20617468-20617490 GTGAGTGAGCAGAAAAAGAGAGG - Intronic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137421618 16:48339800-48339822 GTGTGTGAGCTGCACAAGAGAGG + Intronic
1138058944 16:53868274-53868296 CTATAAAAGCAGAAAAAGAGTGG - Intronic
1140454517 16:75097214-75097236 CTGGGCTAGCAGAACAAGCGTGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1142548941 17:725873-725895 CTGTGTCAGAAGAACAAAGGTGG - Intergenic
1142646360 17:1316134-1316156 CTGTTTAAGCAGCCCATGAGTGG - Intergenic
1149524302 17:57342020-57342042 GTGTTTAACCAGAACAAAAGAGG + Intronic
1150597631 17:66620372-66620394 CTGGGTAGGCAGAAGAAAAGGGG + Intronic
1151807519 17:76415325-76415347 CTGTGGAATGAGAACAAGAGTGG - Intronic
1153560030 18:6362429-6362451 CTCTGTTAGCAGAAGGAGAGAGG - Intronic
1155719925 18:28999260-28999282 CAATGTAAGCAAAACAAGAAAGG + Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1160233256 18:77065327-77065349 CTTTGTAAGGAGAGGAAGAGAGG - Intronic
1160313646 18:77820909-77820931 CTGTGCAGGGAGAACCAGAGTGG + Intergenic
1161383249 19:3977582-3977604 CTGTGTGAGGAGAACATGCGGGG - Exonic
1161686076 19:5703310-5703332 CTGAGTGAGCAGAACCACAGAGG + Intronic
1162794122 19:13077990-13078012 CTGTGCAGGCAGAGCCAGAGGGG - Intronic
1168554481 19:57326610-57326632 CTGTGCATGGAGAACAAAAGAGG - Intronic
925784388 2:7416564-7416586 TTATGGAAGCAGAAAAAGAGTGG - Intergenic
927487780 2:23500925-23500947 CTGTTTAATGAGAACAAAAGTGG + Intronic
927579428 2:24228730-24228752 CTGTGTCAGCAGAACAAAAAGGG + Intronic
929384155 2:41384414-41384436 CTGTGTAAGCACAGGAAGAAAGG - Intergenic
930587804 2:53290074-53290096 CTGTGTATGCAGCATAAAAGAGG + Intergenic
931292657 2:60889244-60889266 CTGTGTCAGTGGAAAAAGAGCGG - Intronic
931975740 2:67642273-67642295 CTGTGTGGCAAGAACAAGAGGGG + Intergenic
933123270 2:78570117-78570139 CTGTGAAATCAGAACACTAGTGG + Intergenic
935124024 2:100207308-100207330 CTCTGTGAGCAGGACATGAGGGG + Intergenic
936831373 2:116652413-116652435 ATGCTTAAGCAGAACAAGAATGG + Intergenic
938129260 2:128696601-128696623 CAGTGTGAGCAGCACAAGCGTGG + Intergenic
939750392 2:146037796-146037818 CTGTATTAGCTGAACAATAGGGG - Intergenic
942544390 2:177047528-177047550 ATGTGCACGCAGAACAAAAGGGG - Intergenic
944251729 2:197585662-197585684 CTGTGTAAGCACAGGAAGAAAGG - Intronic
944763710 2:202842751-202842773 GAGTTTAAGCAGAAGAAGAGAGG - Intronic
1169152577 20:3301579-3301601 CTGTGTAAGTGGCCCAAGAGGGG - Intronic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1171055269 20:21900488-21900510 ATGTGTAAGCAGGAAGAGAGTGG + Intergenic
1171116086 20:22525986-22526008 ATGTGCATGCAGAACAAGAGTGG + Intergenic
1178462855 21:32818631-32818653 CTGAGGAAGCAGACCATGAGAGG - Intergenic
1178911720 21:36679847-36679869 CTGAGCAACCAGAACAAGAGAGG - Intergenic
1179526146 21:41977160-41977182 CTGTGTAACCAGAACAGGAATGG + Intergenic
1181327861 22:22064695-22064717 CTGTGTTTAGAGAACAAGAGAGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
949095165 3:77187-77209 CTCTCTCAGCAGAGCAAGAGGGG + Intergenic
950327117 3:12121226-12121248 ATGTGTAAGCAGAAAGAGACAGG - Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
955513540 3:59705230-59705252 CTGTATAAGAAGAAAAAGTGTGG + Intergenic
962892436 3:139684117-139684139 CTTTGTAAGCAGAACAGGAATGG - Intergenic
963450104 3:145468648-145468670 CTCCTTAAGCAGAAAAAGAGTGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964505179 3:157391283-157391305 CTGTGTCATCAGTACATGAGAGG + Intronic
964708182 3:159643346-159643368 TTCTGTAAGCACATCAAGAGTGG + Intronic
965576642 3:170223851-170223873 CTTTGAAATCAAAACAAGAGAGG - Intronic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968693246 4:2007722-2007744 CTGTGTAAGGATCACAGGAGTGG + Intronic
968794263 4:2691912-2691934 ATGTGTAAGAAGGATAAGAGTGG + Intronic
969233503 4:5848819-5848841 CTTTATAAGGAGAAGAAGAGAGG - Intronic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970565774 4:17331151-17331173 ATGTGGAAAGAGAACAAGAGTGG - Intergenic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
973537311 4:51896413-51896435 CTGTCTACGAAGAAGAAGAGCGG - Intronic
974248411 4:59353448-59353470 CTGTGTAAGAAGAACAAAGCTGG - Intergenic
974349414 4:60724902-60724924 CTGAGAAAGCAGGACAAGAAAGG + Intergenic
974689823 4:65282960-65282982 CTGTGTCAGCAGGTCTAGAGTGG + Intergenic
977792157 4:101118880-101118902 TTGTGTAACTGGAACAAGAGAGG + Intronic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981900555 4:149856987-149857009 ATGAGTGATCAGAACAAGAGTGG + Intergenic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
985248476 4:187999631-187999653 CTGTGTGAACAGAACAGAAGAGG + Exonic
986043326 5:4013616-4013638 CTCTGTAAGCAGAACAATACTGG + Intergenic
987924445 5:24321608-24321630 CTGTGTATGCTGTAAAAGAGTGG + Intergenic
988706619 5:33732288-33732310 CTTTGTAAGCATAAAAAGAATGG + Intronic
990716354 5:58641569-58641591 CTGAGTAAGGAGTAGAAGAGAGG - Intronic
991607916 5:68421872-68421894 CTGAGTAAGCAGAGCAGGATGGG + Intergenic
993481676 5:88431601-88431623 TTGTGAAAGCACAACAAGAGTGG + Intergenic
996210761 5:120806539-120806561 CTGTGAAAGCAGCACAGAAGTGG - Intergenic
1000412774 5:160950880-160950902 CTGTGTACTCAGAATAAGAAAGG + Intergenic
1003220230 6:4154671-4154693 TTTTGGAAGCAGAACAAAAGTGG + Intergenic
1003448171 6:6204492-6204514 ATGTATTAGCAGAACCAGAGAGG - Intronic
1007900536 6:45407465-45407487 TTGTGGAAGAAGAATAAGAGTGG - Intronic
1008191716 6:48466670-48466692 CTGAGTAAGAAGAACAAAACTGG + Intergenic
1008835672 6:55824803-55824825 CTGTCTAACAAGACCAAGAGGGG + Intronic
1011083437 6:83512936-83512958 CTGCTTAAGCAGTACCAGAGGGG + Intronic
1011169911 6:84493871-84493893 CTGAGTAGGCAGAGCAAGAATGG + Intergenic
1013179197 6:107703901-107703923 GTGTGAAAGAAGAAGAAGAGAGG + Intergenic
1014292081 6:119570573-119570595 AGTTGTAAGGAGAACAAGAGAGG - Intergenic
1014634657 6:123830240-123830262 CTGTGTAAAGAAGACAAGAGGGG - Intronic
1015173691 6:130282542-130282564 CTTTGTATTCAAAACAAGAGGGG + Intronic
1015175744 6:130306242-130306264 CTGTCTAAGCAGAAAAATATAGG + Intronic
1016250907 6:142041183-142041205 CTGTGTATGCAGTGGAAGAGTGG - Intergenic
1017410207 6:154160041-154160063 CTGTGTGAGTAGAAAAAAAGGGG + Intronic
1017461568 6:154655884-154655906 CAGGGAGAGCAGAACAAGAGAGG + Intergenic
1022913405 7:34921788-34921810 GTGTGTAAGCATACCCAGAGAGG + Intergenic
1023385415 7:39652143-39652165 CTATGGCAGCAGAGCAAGAGAGG + Intronic
1024291411 7:47807337-47807359 CTGTGTAAGGAGAACCAGGCAGG - Intronic
1024627855 7:51223648-51223670 CTTTGAGAGCAGAACAAGTGAGG - Intronic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1031932426 7:127699479-127699501 CTCTGAAAACAGAACAAGTGAGG - Intronic
1038098574 8:24344450-24344472 CTGTGTATATAGAACAAGATTGG - Intronic
1040722301 8:50339701-50339723 CTGAGAAGGCAGAAAAAGAGGGG + Intronic
1040845456 8:51833224-51833246 CTGGGTAAGCAAAACAAAGGAGG + Intronic
1041956973 8:63566755-63566777 CTGTGCAACCTGAAAAAGAGTGG - Intergenic
1045104924 8:98883209-98883231 CTGTGGAAGGAGAACAGTAGAGG - Intronic
1046211921 8:111087490-111087512 CTGTGTTAGCAGTACAACTGGGG - Intergenic
1046356370 8:113090698-113090720 ATATGTAAGCATAACAAGACAGG - Intronic
1048730894 8:137439718-137439740 CTGGGAAAGCAAAACAAGAATGG + Intergenic
1049168597 8:141143050-141143072 CTGTGTGATCAGAACTAGAAGGG + Intronic
1051526067 9:18046086-18046108 CTGTGAAAGCAAAACCACAGTGG + Intergenic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1052140077 9:24970328-24970350 TTGTGTAGGCTGAAGAAGAGGGG - Intergenic
1052342522 9:27377927-27377949 CTGTGAGAGCAGAGCAAGACAGG - Intronic
1056102182 9:83310566-83310588 CTGGGTAAGAAGAAAAAAAGTGG + Intronic
1057558824 9:96111352-96111374 CTGTGGAAGCAGAAAGTGAGGGG + Intronic
1057863970 9:98664675-98664697 CTGGGTCAGCTGAGCAAGAGAGG + Intronic
1057915181 9:99049829-99049851 GTGGGTAATGAGAACAAGAGAGG - Intronic
1058694181 9:107545451-107545473 CTGTTTAAGCAGAACCGGGGTGG - Intergenic
1059472183 9:114514005-114514027 CTGAGGAAACAGAACCAGAGGGG - Intergenic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1187033521 X:15513144-15513166 CTGTGAGAGAAGAACAAAAGTGG - Intronic
1187674819 X:21705608-21705630 CTGAGCAAACAGAACAAGAGAGG - Intergenic
1189066856 X:37819159-37819181 CTGTGTAAAGAGAACAGAAGAGG + Intronic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1193022841 X:76810287-76810309 CAGTGAAAGCAGAACAAAAAGGG + Intergenic
1195618210 X:106929444-106929466 CTGTGGAGTCATAACAAGAGTGG - Exonic
1195957978 X:110354211-110354233 TTGAGTAAGAAGAACAAGGGTGG + Intronic
1196598656 X:117575273-117575295 CTGTGTGTTCAGAACAAAAGAGG - Intergenic
1197324393 X:125074324-125074346 CTGGGGAAGCAGACCCAGAGTGG - Intergenic
1197686665 X:129446281-129446303 CTATGTATGCAGAAGAAGGGGGG - Intergenic
1198972314 X:142296234-142296256 CTGCGTATGCAGAAAAAAAGTGG + Intergenic