ID: 951066593

View in Genome Browser
Species Human (GRCh38)
Location 3:18273736-18273758
Sequence GAATACTAATTAAAGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951066593 Original CRISPR GAATACTAATTAAAGATCTC AGG (reversed) Intronic
900007079 1:66055-66077 GAATATCATTTAAAAATCTCTGG - Intergenic
904635923 1:31881328-31881350 GAAGACTATTTAAAGAACTGGGG + Intergenic
906088716 1:43158864-43158886 GACTTCCAATTAAAGATCTTAGG + Intergenic
906095077 1:43217430-43217452 GAATACTTATCAATGATCCCAGG - Intronic
908242673 1:62200754-62200776 GAATAGTTATTAAACATTTCAGG - Intronic
909083923 1:71149472-71149494 AAAAACTAATTAAAGCTCTATGG + Intergenic
909685393 1:78342318-78342340 ATATACTAGCTAAAGATCTCTGG + Intronic
914330649 1:146667260-146667282 AAATGATAATTAAAAATCTCAGG + Intergenic
918655103 1:187015648-187015670 GTATACTAATTTCAGTTCTCTGG - Intergenic
918776690 1:188641173-188641195 AAATACTAAGTAAAGAGATCAGG + Intergenic
924824758 1:247527505-247527527 AAAGACTAATTAAAAATCTCTGG - Intronic
1063041490 10:2343131-2343153 TTAAACTAATTACAGATCTCAGG - Intergenic
1063788814 10:9416065-9416087 GAATACTAATAAAAAAACACAGG - Intergenic
1064360964 10:14663828-14663850 GAATACAAATTATAGAACTCAGG + Intronic
1064487293 10:15807135-15807157 GTATGCTAATTAATCATCTCAGG - Intronic
1065215372 10:23443198-23443220 GTTTACTAATCACAGATCTCTGG + Intergenic
1067094348 10:43288836-43288858 CAATACTTCTTAAAGATCTCTGG + Intergenic
1068392306 10:56414189-56414211 GAATGCTAATTGAAGAGCCCTGG - Intergenic
1068695166 10:59959846-59959868 GAATGTGAATGAAAGATCTCAGG - Exonic
1068991770 10:63158186-63158208 GTAGCCTAATCAAAGATCTCTGG + Intergenic
1069081118 10:64089023-64089045 GAATGCCAAATGAAGATCTCAGG + Intergenic
1070315063 10:75302472-75302494 GAATGCTAATTACAGATATGTGG + Intergenic
1075929476 10:126283386-126283408 GAAAACAATTTAAAGATCCCTGG - Intronic
1076805300 10:132854018-132854040 GAATAAAAATTAAAGATCTGAGG - Intronic
1078856501 11:15209691-15209713 AAATACCAATTGAAGATTTCTGG + Intronic
1078958190 11:16227807-16227829 GAATAGTAATTAAAGACCTAGGG - Intronic
1079107958 11:17585984-17586006 GGGCACTTATTAAAGATCTCAGG - Intronic
1081074891 11:38659438-38659460 GAATACTAACAAAAGATTACTGG + Intergenic
1081148174 11:39590886-39590908 GAAAACTAATAAAAGATCTTAGG - Intergenic
1081594107 11:44447306-44447328 GAAGATTAATTAAAGTTGTCAGG + Intergenic
1082615986 11:55359811-55359833 AAATACAACTTAAAAATCTCTGG + Intergenic
1083125751 11:60564202-60564224 GCAAACTAATAAAAGATCTCAGG - Intergenic
1083126618 11:60574663-60574685 TAATACTAATAAAAGAATTCAGG + Intergenic
1084368341 11:68718372-68718394 TAATTCTTATTAAAAATCTCAGG + Intronic
1085912736 11:80847693-80847715 GACTACTAATAAACCATCTCAGG - Intergenic
1086415912 11:86588812-86588834 CAACATTATTTAAAGATCTCTGG + Intronic
1086749789 11:90477592-90477614 GAATACCAATTACAGTTTTCTGG + Intergenic
1087268366 11:96085122-96085144 GGATACTAATTAGAGAACTCTGG - Intronic
1089908302 11:122068728-122068750 GCATAATAATTCAAAATCTCTGG - Intergenic
1090117728 11:123992615-123992637 GAAGACTAATTAACTATCTTAGG - Intergenic
1093544271 12:20327900-20327922 GAAGACTAAATAGAGAACTCTGG + Intergenic
1095294277 12:40510686-40510708 GTATACTTATTCAATATCTCAGG - Intronic
1096368028 12:51045149-51045171 AAACACTAAATAAATATCTCAGG + Intergenic
1098258334 12:68640935-68640957 AAATACTAGTTAATAATCTCCGG + Intronic
1099855173 12:88155607-88155629 GACTACTACATAAAGATCTAAGG - Intronic
1100354876 12:93819487-93819509 AAATTCTGATTAAACATCTCTGG + Intronic
1104250943 12:127093158-127093180 GAACACTGATTAAATTTCTCTGG + Intergenic
1104765578 12:131328076-131328098 GAATCCTAATTACAGCTCCCTGG + Intergenic
1104813745 12:131633976-131633998 GAATCCTAATTACAGCTCCCTGG - Intergenic
1106208008 13:27617449-27617471 TAATACAATTTAAAGATATCGGG + Intronic
1106581319 13:31020831-31020853 GCATAATACTCAAAGATCTCTGG - Intergenic
1106864813 13:33951905-33951927 GAATAGTTATTTAAGCTCTCCGG - Intronic
1106986050 13:35352457-35352479 GAAGAATTATTAAAGATTTCAGG - Intronic
1107123739 13:36821860-36821882 GCATACTAATTAATGGGCTCAGG + Intronic
1107324363 13:39225109-39225131 AAATACGAGATAAAGATCTCAGG - Intergenic
1108069778 13:46616558-46616580 CAACACTATTTAAAGTTCTCTGG - Intronic
1109182678 13:59232594-59232616 AAAGACTGATTAAAGATCTTGGG + Intergenic
1110108056 13:71704668-71704690 AAATAAAAATAAAAGATCTCTGG + Intronic
1112057058 13:95699168-95699190 GAATAATAATTAATTCTCTCTGG + Intronic
1112953248 13:105028920-105028942 GAATAATAAATAAAAATGTCAGG + Intergenic
1113277633 13:108750413-108750435 GAATACTACGTAAAGATGTTTGG - Intronic
1115319733 14:32066846-32066868 TAATTCTAATAAAAGAGCTCTGG - Intergenic
1115908766 14:38231880-38231902 GAATACCCAGTAAAGATCTGTGG + Intergenic
1116283822 14:42946111-42946133 GAGTACTAATCCAAGATCTGTGG + Intergenic
1116648312 14:47558497-47558519 AAATAATAAGTAAACATCTCTGG + Intronic
1116740174 14:48744708-48744730 GAATACCACTTATAGATCCCAGG - Intergenic
1118549857 14:66938475-66938497 GAATAATAATTAATTATCACAGG - Intronic
1119724131 14:76911783-76911805 GAACACTGATTGAAGAACTCAGG - Intergenic
1119866022 14:77975311-77975333 GAATATGCATTAAACATCTCTGG + Intergenic
1122915730 14:104857633-104857655 GGAGACTATTTAATGATCTCAGG - Intergenic
1123205191 14:106705530-106705552 GAATAATAATTTCAGATTTCAGG - Intergenic
1123210186 14:106751970-106751992 GAATAATAATTTCAGATTTCAGG - Intergenic
1125372762 15:38995939-38995961 CAATACTAATTAAAGGTCATTGG + Intergenic
1125551561 15:40548859-40548881 GAATATTGACTGAAGATCTCAGG + Intronic
1132186896 15:99807986-99808008 TATTGCTAATTAAAGATGTCTGG - Intergenic
1132428793 15:101744735-101744757 TATTGCTAATTAAAGATGTCTGG + Exonic
1133576896 16:7100098-7100120 ACATACTAAATAAAGCTCTCTGG + Intronic
1134019186 16:10909716-10909738 AAATAAAAATAAAAGATCTCAGG - Intronic
1135089902 16:19505423-19505445 GAGTTCTAATTAATTATCTCTGG - Intronic
1137462565 16:48678800-48678822 AAATAATAATTAAAGCTCTCTGG + Intergenic
1138822549 16:60279290-60279312 GAAACCTAATGAAAAATCTCTGG + Intergenic
1139157397 16:64460272-64460294 GAATACTGAATAACAATCTCTGG + Intergenic
1140978399 16:80082898-80082920 GAGTACTAAATAAATATCTGTGG - Intergenic
1144314841 17:14049965-14049987 GCATGGTAAATAAAGATCTCTGG + Intergenic
1153500065 18:5739919-5739941 AAATACTAATGAGAGATCTTGGG + Intergenic
1156814473 18:41293221-41293243 CAATACTAATTTAAGTTCTTTGG + Intergenic
1159479023 18:68963258-68963280 GAATAAAAATTAAGGATTTCTGG + Intronic
1159567476 18:70068826-70068848 GATTATAAATTGAAGATCTCAGG - Intronic
1160638834 19:107639-107661 GAATATCATTTAAAAATCTCTGG - Intronic
1168490801 19:56807257-56807279 GAAGACTAATTCAAGATGACAGG + Intronic
925095749 2:1199646-1199668 TAATACTAATAAAATATTTCAGG + Intronic
926405899 2:12552254-12552276 GAATACTAAGAAAAGATCTTTGG + Intergenic
931156288 2:59634498-59634520 GAATAATTATAAAGGATCTCAGG - Intergenic
932105845 2:68941931-68941953 GAAAACTAATAAAAGAACTCTGG - Intergenic
933006016 2:76995925-76995947 GAATACTATTTAAAAAACTCAGG + Intronic
933330780 2:80890528-80890550 GGATACTAGTAAAAGATCCCAGG + Intergenic
933482858 2:82878975-82878997 AAATACTAATAAAAGAACACTGG + Intergenic
934756965 2:96831072-96831094 GAAGATTATTTAAAAATCTCCGG - Intronic
936369089 2:111887970-111887992 GAATAATAAATAAAGTGCTCAGG + Intergenic
939015133 2:136893917-136893939 AAATACAAATTAACCATCTCAGG + Intronic
940193287 2:151065175-151065197 GAAGAGTAATTAAAGAACTATGG + Intergenic
942051112 2:172141872-172141894 GAAGCCTAATTAAAGTTGTCAGG - Intergenic
942669819 2:178363245-178363267 GAATGGTAAATAAAGATCTCGGG + Intronic
945758692 2:213883552-213883574 GAATACTAACAAAGGAACTCTGG - Intronic
1170880586 20:20293580-20293602 GAATAGTAATTCAATTTCTCTGG - Intronic
1176689789 21:9891646-9891668 CATTTCTAATTAAAGATCTTAGG + Intergenic
1176923088 21:14712693-14712715 GAATAGTAATAAATTATCTCAGG - Intergenic
1177393931 21:20509690-20509712 GAATATTTCTTAAAGAACTCTGG + Intergenic
1182717710 22:32371515-32371537 GAATAGTAATTAATGAGCTTGGG - Intronic
949161386 3:886971-886993 TAATACTGATTAAAAATCTAAGG + Intergenic
951066593 3:18273736-18273758 GAATACTAATTAAAGATCTCAGG - Intronic
952007269 3:28856317-28856339 GAATACCTATTAAACATCTCAGG - Intergenic
952242529 3:31547316-31547338 GAATATTAATTATAAATCTCTGG - Intronic
953500281 3:43426444-43426466 CACTACTAATTATAGCTCTCAGG - Intronic
954979629 3:54733153-54733175 GAACACTACTTAACTATCTCGGG + Intronic
958869734 3:99543708-99543730 GAATACCAATTAAACAACTTTGG + Intergenic
959144532 3:102528876-102528898 GAATTGTATTTAAAGCTCTCAGG - Intergenic
959448061 3:106465054-106465076 GAAAACAAATTAAAAATGTCAGG - Intergenic
959604971 3:108232667-108232689 GAATTCTAGTCAGAGATCTCTGG - Intergenic
959716920 3:109443413-109443435 GAATCATAATTAAAGCTCTATGG - Intergenic
959762708 3:109986889-109986911 GATTACCTGTTAAAGATCTCAGG - Intergenic
961509536 3:127392409-127392431 GACAATTAATTAAAGATCCCAGG + Intergenic
963639559 3:147841877-147841899 GAATCCTAATTAAATATGTTAGG + Intergenic
963712872 3:148767674-148767696 GAAAACTAGCTACAGATCTCAGG + Intergenic
963951200 3:151203492-151203514 GATTAATAATTAAAGATATAAGG + Intronic
965343815 3:167522564-167522586 GATTACTAATTAAAGTCCTGGGG + Intronic
967759120 3:193204021-193204043 GAATTTAAATCAAAGATCTCAGG + Intergenic
970219128 4:13790730-13790752 CAATACAAATGATAGATCTCTGG - Intergenic
971444993 4:26734123-26734145 GAATACTAAGTAGAAATTTCAGG + Intronic
971848797 4:31957253-31957275 GAATATTAATTATAGATGTCAGG + Intergenic
974591505 4:63953789-63953811 TAAAAATAAATAAAGATCTCCGG - Intergenic
974954899 4:68626247-68626269 GCATACTAATTAGAAATCTTAGG + Intronic
978322139 4:107509232-107509254 GAATAGTAAATAAAGATATTGGG - Intergenic
978926738 4:114254707-114254729 GAAAACTAACAAAAAATCTCTGG + Intergenic
978983079 4:114975174-114975196 GAATACTTATTAATGCACTCAGG - Intronic
981103708 4:140857345-140857367 GAATACCAATTAAGAAACTCAGG - Intergenic
981491276 4:145342767-145342789 GAACACTAACTGAATATCTCAGG + Intergenic
982394874 4:154905462-154905484 GAATAATACTCAAAGATTTCAGG - Intergenic
982492867 4:156051147-156051169 AAATACTCATTAAACATGTCTGG - Intergenic
984047768 4:174822791-174822813 GCATACAATTTAAAGGTCTCTGG - Intronic
986871865 5:12058147-12058169 GGATGTTAATAAAAGATCTCTGG + Intergenic
987085803 5:14466331-14466353 GAACCCAAATGAAAGATCTCAGG - Intronic
987326327 5:16814499-16814521 GAAAACTAATGCAACATCTCTGG + Intronic
989175716 5:38523543-38523565 GCAGACAAATTCAAGATCTCTGG + Exonic
989800238 5:45528864-45528886 GCAAAATAATTAAAGATCACAGG + Intronic
991118811 5:62986600-62986622 GAATACTAACAAAAAAACTCTGG + Intergenic
991918974 5:71634880-71634902 GGAAAATAATTAAATATCTCAGG - Intronic
992583557 5:78207918-78207940 GAATACTAATCCAAGAGCCCAGG + Intronic
994228723 5:97286969-97286991 AAATACTAAGAAAAGATCTAAGG - Intergenic
994703688 5:103172043-103172065 AAAAACTGATTAAAGATTTCTGG - Intronic
996003365 5:118390010-118390032 GAATAAAAATTAAAAATATCAGG - Intergenic
996776530 5:127138283-127138305 TATTGCTAATTAAAGATGTCTGG - Intergenic
996794090 5:127325357-127325379 CAATACTCATTAAAGATCTAAGG - Intronic
998510562 5:142710606-142710628 GGATACTAATTTAAAATATCTGG + Intergenic
998924610 5:147108152-147108174 GAATATTAATTAAAGTTGTTTGG - Intergenic
1004114493 6:12752676-12752698 GAATACTAATTAAACACTTAAGG + Intronic
1005699925 6:28390329-28390351 GAATTCTTATTAAATATCTGAGG + Intronic
1006038870 6:31236747-31236769 GAATACTAATAAAAGATGAATGG - Intergenic
1008622140 6:53281004-53281026 GAATGCTACTGAAACATCTCAGG + Intronic
1008828955 6:55734995-55735017 AAATACTTAGTAAAGATCTTGGG - Intergenic
1010131754 6:72502351-72502373 GAATACTCATTAAAGTATTCTGG + Intergenic
1011625054 6:89275897-89275919 GAACACGGATTAAAGCTCTCCGG + Intronic
1013967395 6:115971555-115971577 GACTACAAATTAAAGACCACTGG - Intronic
1019030545 6:169006691-169006713 GAAAATTAATAAAACATCTCTGG - Intergenic
1020434184 7:8144782-8144804 AAATACAAAATAAACATCTCAGG + Intronic
1020768518 7:12356898-12356920 GATTTCTAATTCAACATCTCAGG + Intronic
1023680583 7:42683070-42683092 GGATACTGATTCCAGATCTCTGG - Intergenic
1024494030 7:50022470-50022492 AAATTCTAATTATAGTTCTCAGG + Intronic
1027411658 7:77926138-77926160 GGAAACTAATTAATGATTTCAGG - Intronic
1027861017 7:83581346-83581368 GAAAAATAATTAAAGATCCATGG - Intronic
1028124972 7:87102577-87102599 GAATCATAATTAAAGCTCTATGG - Intergenic
1028925113 7:96349139-96349161 GAATACTCGTTCATGATCTCTGG + Intergenic
1030314169 7:108097402-108097424 AAAAAATAATTAAAGAGCTCAGG - Intronic
1030827556 7:114178790-114178812 CAAAACTAATTAAAGATCCTGGG - Intronic
1031164973 7:118216952-118216974 GAACTCAAATTCAAGATCTCAGG - Intronic
1031224804 7:119022132-119022154 GAATTCTAAATAATGATCTTAGG + Intergenic
1034030286 7:147755022-147755044 GAATTTTATGTAAAGATCTCAGG - Intronic
1037362771 8:18091516-18091538 AAATACAAATTCCAGATCTCAGG + Intergenic
1037971612 8:23175909-23175931 AAATACTAATAACAGATTTCTGG - Intergenic
1038026471 8:23595437-23595459 CAATAGCAATTAAAGGTCTCAGG + Intergenic
1038947315 8:32375458-32375480 TAGTCCTTATTAAAGATCTCGGG + Intronic
1042234065 8:66590203-66590225 TAATACTATTTCAAGATCTCAGG + Intronic
1042873138 8:73416067-73416089 ATATACTAATTTGAGATCTCTGG + Intergenic
1043217462 8:77610603-77610625 GAATAATAATAAAAAATCTTAGG - Intergenic
1043517796 8:81012143-81012165 GATTACTAACAAAAGATCCCAGG - Intronic
1043565046 8:81538423-81538445 AGATACTAATTAAGGATCTCAGG + Intergenic
1046470636 8:114669363-114669385 GAAAACTAATCAAATAGCTCAGG + Intergenic
1048096994 8:131307782-131307804 TAATAATAATAAAAGATCTTTGG - Intergenic
1057345231 9:94244770-94244792 GAGTACTAAATAATGAACTCAGG + Intergenic
1057507267 9:95645605-95645627 GATTACTGACTACAGATCTCAGG - Intergenic
1058875457 9:109240517-109240539 AAATACTAATAAAACATTTCAGG + Intronic
1059584342 9:115590064-115590086 GGATACCAGTTAAAGAACTCTGG + Intergenic
1060507351 9:124208164-124208186 GAGATGTAATTAAAGATCTCAGG - Intergenic
1194562568 X:95440676-95440698 GAATACTGATTGAAGAGATCTGG + Intergenic
1195164064 X:102200048-102200070 TGAATCTAATTAAAGATCTCAGG + Intergenic
1195194796 X:102487047-102487069 TGAATCTAATTAAAGATCTCAGG - Intergenic
1196086348 X:111686696-111686718 AAATACTAATTAAAAGTATCTGG - Intronic
1196467609 X:115989250-115989272 GTATACTAATTTAGCATCTCTGG - Intergenic
1196961399 X:121006728-121006750 GAAGGTTATTTAAAGATCTCAGG - Intergenic
1197138325 X:123088846-123088868 GAAGACTGATTAAAGATCAAAGG - Intergenic
1200782289 Y:7227671-7227693 TATTACTAATAATAGATCTCTGG - Intergenic