ID: 951068580

View in Genome Browser
Species Human (GRCh38)
Location 3:18297228-18297250
Sequence CTTATTATCAGAAATCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951068574_951068580 11 Left 951068574 3:18297194-18297216 CCTATAAGGAAACCCCTAACTGA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 951068580 3:18297228-18297250 CTTATTATCAGAAATCTGACAGG 0: 1
1: 0
2: 2
3: 20
4: 189
951068577_951068580 -2 Left 951068577 3:18297207-18297229 CCCTAACTGACTAACCATGGACT 0: 1
1: 0
2: 0
3: 5
4: 67
Right 951068580 3:18297228-18297250 CTTATTATCAGAAATCTGACAGG 0: 1
1: 0
2: 2
3: 20
4: 189
951068578_951068580 -3 Left 951068578 3:18297208-18297230 CCTAACTGACTAACCATGGACTT 0: 1
1: 0
2: 2
3: 21
4: 151
Right 951068580 3:18297228-18297250 CTTATTATCAGAAATCTGACAGG 0: 1
1: 0
2: 2
3: 20
4: 189
951068576_951068580 -1 Left 951068576 3:18297206-18297228 CCCCTAACTGACTAACCATGGAC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 951068580 3:18297228-18297250 CTTATTATCAGAAATCTGACAGG 0: 1
1: 0
2: 2
3: 20
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951068580 Original CRISPR CTTATTATCAGAAATCTGAC AGG Intronic
900838309 1:5024352-5024374 ATTATAATCAGGAATCAGACAGG + Intergenic
905785063 1:40748804-40748826 CTTATTATATCAAATCTCACAGG - Intronic
907520192 1:55018719-55018741 CATATTTTCAGAAAGCTGAGTGG + Intergenic
911292140 1:96070388-96070410 CTTCTTAGCAGAAATCTCACAGG - Intergenic
911940296 1:104037669-104037691 TTTATTAACACAAATCTGACAGG - Intergenic
912588501 1:110788823-110788845 TTTATCCTCAGAAATCTTACAGG + Intergenic
912848241 1:113096814-113096836 CTTATTATCTGATATGTGCCAGG + Intronic
913351732 1:117868774-117868796 CTTAACATCCGACATCTGACTGG + Exonic
913705430 1:121417203-121417225 ATTATTGTCCGAAATATGACTGG - Intergenic
915028742 1:152857895-152857917 CTTTTTGTCAGAAATATCACAGG + Intergenic
915767241 1:158374737-158374759 TTTATGAGCAGAAATCTCACAGG + Intergenic
917481437 1:175415353-175415375 GTTCTTTTCAGAAATCTGACAGG - Intronic
918120975 1:181540096-181540118 CTTATTATAAACAATCTGAAGGG - Intronic
919290916 1:195629256-195629278 TTCATTAGCAGAAATCTTACAGG + Intergenic
923244342 1:232117840-232117862 CTTATTAGCTGAAAGCTGAAAGG - Intergenic
924925949 1:248680816-248680838 GTTATTTTTAGAAATCTGTCAGG - Intergenic
1062890318 10:1055048-1055070 TTTATTGTCAGAGGTCTGACTGG - Intronic
1063781268 10:9328025-9328047 CATATAAGCAGAAATCTCACAGG + Intergenic
1065283762 10:24167203-24167225 CTTTTTATCAGAAAGATGAAAGG - Intronic
1066143816 10:32535644-32535666 CTTATTATACGAAATCTCATAGG + Intronic
1066179663 10:32948029-32948051 ATTATAACCAGAAAACTGACTGG + Intronic
1068038622 10:51793687-51793709 CTTCTCAGCAGAAATCTGTCAGG + Intronic
1068804419 10:61178775-61178797 GTTATTATCAGAATGCTGACTGG - Intergenic
1071787245 10:88915701-88915723 CTTATTATTAGTCATCTGTCTGG - Intronic
1072179249 10:92964653-92964675 GTTATTAACAGAAAATTGACAGG + Intronic
1074510011 10:114102999-114103021 CTTAATTTCAGAAATCGGCCGGG - Intergenic
1078978305 11:16503012-16503034 TTTATCAGCAGAAATCTTACAGG + Intronic
1080399148 11:31917969-31917991 CTTACTGTCAGAAGTCTGAGTGG - Intronic
1081517199 11:43844600-43844622 ATTATTATAAGTAATTTGACTGG + Intronic
1081924947 11:46818134-46818156 TTTATTCTCAGAAATCTAAATGG - Intronic
1082819616 11:57536077-57536099 TTAATTAACAGAAATATGACAGG - Intergenic
1083124166 11:60546533-60546555 CTTCTTAGCAGAAATTTTACAGG + Intergenic
1083137748 11:60695023-60695045 CTTTTCAGCAGAAATCTTACAGG + Intergenic
1083533579 11:63448028-63448050 CTTAATATCATACATCTGCCAGG + Intergenic
1087356413 11:97099550-97099572 CTTCTCAGCAGAAACCTGACAGG + Intergenic
1088970222 11:114767901-114767923 CTGATTATTAGCTATCTGACGGG + Intergenic
1090179416 11:124683035-124683057 CTTCTCAGCAGAAACCTGACAGG + Intronic
1091905098 12:4179306-4179328 CTTATTGTCAGAAATAGTACAGG + Intergenic
1092347628 12:7728971-7728993 CTTATTTTCCGACAGCTGACGGG - Intergenic
1092956136 12:13552075-13552097 CATAGTCTCTGAAATCTGACAGG - Exonic
1093803274 12:23400097-23400119 CATAGTATCAGAGATCTGAGGGG + Intergenic
1094275201 12:28667814-28667836 CTTCTTAGCAGATATCTTACAGG + Intergenic
1098701287 12:73630881-73630903 CTTATTATAATAGATCTGACAGG + Intergenic
1100930982 12:99609251-99609273 CTTATTATCAGATTTCAGCCAGG + Intronic
1105745211 13:23371154-23371176 CTTTTTTTCAGTTATCTGACTGG - Exonic
1107311876 13:39087196-39087218 CTTATTACCTGAGATTTGACAGG + Intergenic
1108136603 13:47369817-47369839 CTTCTCAACAGAAATCTTACAGG + Intergenic
1109306326 13:60645909-60645931 CTTCTTAGCAGCAATGTGACTGG - Intergenic
1110301512 13:73934566-73934588 CTTCTTATCTGAAATCAGTCAGG - Intronic
1111052383 13:82901701-82901723 TTTATTATCAGAAATATGACAGG - Intergenic
1115866662 14:37755081-37755103 CTTTTTATCAGCATTCTAACTGG + Intronic
1117400643 14:55355873-55355895 TTTAGTATGAGAAACCTGACAGG + Intronic
1120152008 14:81046870-81046892 CTTATTGTCAGAAACTTCACAGG + Intronic
1120366389 14:83576536-83576558 ATTATTCTCTGAAATCTGTCAGG + Intergenic
1121753838 14:96384909-96384931 TTTATTATTAGTAATCTGAAAGG - Intronic
1124123992 15:26919939-26919961 TTTTTTATCAGAAATCTTGCAGG - Intronic
1125323855 15:38516142-38516164 CTTATTTTCAGAAATATCCCAGG + Intronic
1126807436 15:52365490-52365512 CTTAATATTATAAATGTGACTGG - Intronic
1126833928 15:52639549-52639571 TTTATAAACAGAAACCTGACTGG - Intronic
1127276837 15:57453605-57453627 CTGAAGATCAGAAATCAGACTGG + Intronic
1127330294 15:57932446-57932468 CTGATTATCTGAAGTCTGCCAGG + Intergenic
1127474148 15:59316538-59316560 CTTAATATCAGAATTCTTTCTGG - Intronic
1128424605 15:67528206-67528228 CAAATTATCAGAAATCAAACAGG - Exonic
1135819322 16:25667142-25667164 CTTCTTAGCAGAAAGCTTACAGG + Intergenic
1140635238 16:76905134-76905156 CATATAATTAGAAATCAGACTGG - Intergenic
1140842662 16:78855318-78855340 CTTATCATAATAAATCTGAGTGG + Intronic
1146398252 17:32485586-32485608 CCTATTGACAGAAATCTGAGTGG + Intergenic
1150194427 17:63280686-63280708 TTTATTAGCAGAAATCTGATAGG + Intronic
1155462896 18:26103353-26103375 CTTCTCATCAGAAATCTCAGGGG + Intergenic
1157697475 18:49734281-49734303 CTTATTATTAGAAACCAGACGGG + Intergenic
1158033997 18:53002615-53002637 CTTATTATCAAAATTCTGAGAGG - Intronic
1158342269 18:56479543-56479565 ATAATTATCAGAAATCTCAAAGG - Intergenic
1159867012 18:73717942-73717964 CTCATTAACAGAAATCTGTTTGG - Intergenic
1166352292 19:42205282-42205304 CTTACTATCAAATATCTGATCGG - Intronic
930118902 2:47743787-47743809 CTTATTATCAGATTTCAGCCAGG - Intronic
930248106 2:49005372-49005394 TTTTTTATCAGTAATCTGCCTGG - Intronic
931726402 2:65115647-65115669 CCAATTACCAGAAATCTGAGAGG + Intronic
932096034 2:68849503-68849525 CTTATTTTCAGAAACCAGAGAGG - Intergenic
932661797 2:73661057-73661079 TTAATAATCAGAATTCTGACTGG + Intergenic
935650266 2:105375873-105375895 AGTATTTTCAGAAATCTGAGGGG + Intronic
938822545 2:134974336-134974358 TTTATCAGCAGAAATCTTACAGG - Intronic
940384953 2:153059435-153059457 TATATTATCACAAATATGACTGG + Intergenic
940556351 2:155233427-155233449 TTCATCATCAGAAATCTTACTGG + Intergenic
940676431 2:156729307-156729329 CTTATGACCACAAATGTGACAGG + Intergenic
941816046 2:169797089-169797111 CCTATTATCAGAAGTCACACCGG - Intronic
942881495 2:180867408-180867430 CTTCTTAGCAGAAACCTTACAGG + Intergenic
943353771 2:186825108-186825130 TTTATTCTTAGAAATCAGACAGG + Intergenic
943614428 2:190076531-190076553 CTTATTTTCAGACATTTCACTGG + Intronic
945570926 2:211466766-211466788 CTTATTATCTGAAATCTATGTGG + Intronic
948404833 2:237709536-237709558 ATTTTTATCCGAAATCTCACTGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1170281311 20:14651949-14651971 CATATTATTACAAATCTTACTGG + Intronic
1171521735 20:25781251-25781273 CACATTACCAGAAATCTGTCTGG - Intronic
1171555106 20:26074800-26074822 CACATTACCAGAAATCTGTCTGG + Intergenic
1172819931 20:37723294-37723316 CTTATGATCTGTAATCTGATTGG - Intronic
1173471267 20:43325372-43325394 CTAATTGTCAGAAATCGGAAAGG + Intergenic
1177474090 21:21595548-21595570 CTGATTATCAGGAATCTGAAAGG - Intergenic
1177746482 21:25221119-25221141 CTTCTCAGCAGAAATCTTACAGG - Intergenic
1183349962 22:37329580-37329602 CTCTGAATCAGAAATCTGACTGG - Intergenic
1184973090 22:48041746-48041768 CTTGTGATCAGAATTCTGAAAGG + Intergenic
951068580 3:18297228-18297250 CTTATTATCAGAAATCTGACAGG + Intronic
951135001 3:19095254-19095276 GTTTTTATTAGAAATCTGATGGG - Intergenic
955375408 3:58391676-58391698 TTTATTATCCAAAATATGACTGG - Intronic
955714547 3:61815098-61815120 ATTATTAAAAGAAATCTGGCTGG + Intronic
957159651 3:76594033-76594055 CATTTTATCAGAAATCTTACAGG + Intronic
957947055 3:87078417-87078439 ATTTTTATCAGAAATCTTTCAGG - Intergenic
958482256 3:94657635-94657657 CATATTATCAGAAATTTGCTTGG + Intergenic
959426682 3:106198512-106198534 TTTATTTTAAGAAATCTGGCCGG + Intergenic
960369889 3:116821966-116821988 ATTATAATCAGTAATCTGGCAGG - Intronic
962537130 3:136340125-136340147 CTTATTCTCAGAATTCTGGGAGG - Intronic
965442448 3:168731155-168731177 CTTTTCAGCAGAAATCTTACAGG + Intergenic
965840738 3:172902600-172902622 CTTATTACAAGAAATTTGAAAGG - Intronic
965912288 3:173793793-173793815 ATCATTCTCAGAAATATGACAGG - Intronic
968699927 4:2050366-2050388 CTTATTATCAGATTTCAGTCAGG - Intergenic
969663107 4:8541845-8541867 CTTACACTCAGAAATCTCACTGG + Intergenic
970525032 4:16923352-16923374 CTTATTATTAGAAAGCTAATTGG - Intergenic
971208770 4:24595949-24595971 CTTCTCATCAGAAAACTGCCAGG + Intergenic
972993186 4:44847547-44847569 CTTATTATCAGAAATGGAAATGG + Intergenic
973189296 4:47368584-47368606 ATTATTCCCAGAAATCTTACAGG + Intronic
974350706 4:60742337-60742359 CTCTTTATCTGAAATCTGCCTGG + Intergenic
977967458 4:103169587-103169609 CTTCTAAGCAGAAATCTCACAGG + Intronic
978740239 4:112129105-112129127 TTTTTTATCAGAAATCTGCTAGG + Intergenic
980242843 4:130200945-130200967 CTTTTTATCAGAATTCTGTGTGG + Intergenic
980366964 4:131817288-131817310 CTTCTCAGCAGAAATCTTACAGG - Intergenic
981694313 4:147544474-147544496 TTTATTATCAGCAATCTGTCTGG - Exonic
983125448 4:163945354-163945376 CTTATTATCAAATATCTCACAGG - Intronic
983877617 4:172895453-172895475 CTTCTTAGCAGAAACCTTACAGG - Intronic
986996979 5:13618672-13618694 TTAATAATCAGAATTCTGACTGG - Intergenic
987845832 5:23283870-23283892 CTTTTTGTCAGACATCTAACAGG + Intergenic
990291614 5:54357725-54357747 CCTATTATCAGAACTCTGAAAGG + Intergenic
990607010 5:57420964-57420986 CTTGTTATCAGAAATCAGTCAGG - Intergenic
990634246 5:57706517-57706539 CTCATTAACAAAAATTTGACAGG - Intergenic
992041877 5:72842932-72842954 CTCTTTATCAGAAATCTAACAGG - Intronic
992638921 5:78751890-78751912 CTTATTTTAAGAAATCAGATAGG + Intronic
993566493 5:89482635-89482657 TTTATTTTCTGAAATCTGGCTGG + Intergenic
996642146 5:125769199-125769221 TTTCTTAGCAGAAATCTTACAGG - Intergenic
997146373 5:131438466-131438488 CTTATTATAATAATTCTAACAGG - Intronic
998347095 5:141474138-141474160 CTTATTATCAAGAAAATGACAGG + Intronic
999485965 5:151996574-151996596 TTTATCAGCAGAAATCTTACAGG - Intergenic
1000695915 5:164383446-164383468 CTTATCAGCAAAAATCTTACAGG - Intergenic
1002037726 5:176485594-176485616 CTGAATATCAGTAGTCTGACAGG + Intronic
1002678451 5:180938764-180938786 TTTCTTAACAGAAATCTTACAGG + Intronic
1003895257 6:10601499-10601521 TTTCTTATCAGAATTCTTACAGG + Intronic
1006050545 6:31339680-31339702 TTTCTTAGCAGAAATCTTACAGG - Intronic
1008526216 6:52409771-52409793 CATATTTTCAGGAAACTGACTGG - Intergenic
1008833004 6:55791942-55791964 TTTATCGTCAGAAATGTGACTGG - Intronic
1009306577 6:62098481-62098503 CTTATCAGCAGAAATCTTACAGG - Intronic
1009616022 6:66008589-66008611 CTTCTTAGCAGAAACCTTACAGG - Intergenic
1010910612 6:81550667-81550689 TTTATTATTAGAAATTTGAGGGG - Intronic
1010915852 6:81618065-81618087 ATTATTATTAGTAATATGACTGG + Intronic
1010933200 6:81828584-81828606 CTTAAGATCAGAAATGGGACAGG + Intergenic
1010986748 6:82433707-82433729 CATATTATCAGCATTCTCACTGG + Intergenic
1011187484 6:84694730-84694752 CTTTTTAATAGAAATCTCACTGG + Intronic
1012026245 6:93995960-93995982 CTTATGATCACAAAAGTGACAGG + Intergenic
1014320450 6:119922541-119922563 CTTCTCAGCAGAAATCTTACAGG - Intergenic
1015932228 6:138373297-138373319 CATATTATAAGAAATGTGTCAGG - Intergenic
1017565661 6:155683042-155683064 ATTATTATGAGAAATCTGCTTGG - Intergenic
1018463768 6:164023616-164023638 CATATTGTCAGGAAGCTGACAGG + Intergenic
1018665025 6:166127544-166127566 TTTATCCTCAGAAATCTGATGGG - Intergenic
1019255170 7:45125-45147 CTTTTTTTGAGAACTCTGACTGG + Intergenic
1020360562 7:7322747-7322769 CTTTATATCAGAGAACTGACGGG + Intergenic
1021386539 7:20037800-20037822 TTCAATATCAGAAATCTGACAGG - Intergenic
1021527781 7:21607982-21608004 CTTACTAACAGAAATCTGCAAGG - Intronic
1021911066 7:25386350-25386372 CATTTTACCAGAAATCTGGCAGG + Intergenic
1022662459 7:32379733-32379755 CTTATTATCAGAAACCAGACAGG - Intergenic
1023978126 7:45047860-45047882 CTTATTATAAGAAATGATACAGG - Intronic
1026359923 7:69594118-69594140 CATATTATCAGATTTCTTACTGG - Intergenic
1026427754 7:70313587-70313609 CTTATTATCAGAAATTTTCTGGG - Intronic
1029938657 7:104455745-104455767 CTAATTATTAGCAATCTGAGAGG - Intronic
1030385390 7:108862506-108862528 TTTCTTAACACAAATCTGACAGG - Intergenic
1031364136 7:120883776-120883798 GTTATTATCTGAAAGCTGCCTGG + Intergenic
1031700822 7:124923834-124923856 CTTTTCAGCAGAAATCTTACAGG + Intronic
1032518712 7:132526399-132526421 CAGATTATAAGAAATCTGACAGG + Intronic
1033685318 7:143634660-143634682 ATTATTTTCTTAAATCTGACAGG + Intronic
1033688488 7:143713879-143713901 ATTATTTTCTTAAATCTGACAGG + Intronic
1033699297 7:143822962-143822984 ATTATTTTCTTAAATCTGACAGG - Intergenic
1035890831 8:3340905-3340927 CTTATTATAATCAATTTGACAGG - Intronic
1039367126 8:36940905-36940927 TTTCTCATCAGAAATCTTACAGG + Intergenic
1039761118 8:40576470-40576492 TTTATTAGCAGAAACCTCACAGG + Intronic
1041095671 8:54347127-54347149 TTTATTATAAAAAATCTGGCTGG - Intergenic
1041542664 8:59003878-59003900 ATTATTTTGTGAAATCTGACTGG - Intronic
1042421301 8:68592414-68592436 CTTATTTTCAGAAATCTGGTTGG + Intronic
1043027562 8:75089683-75089705 CTAATAATCCCAAATCTGACTGG + Intergenic
1043289500 8:78579523-78579545 CTTATTTTGAGGAATCTTACAGG - Intronic
1045632942 8:104148114-104148136 CTTATTATAAGAAAACTTACAGG + Intronic
1047050112 8:121101605-121101627 CTTATTATCAGAGTTTTGAGAGG - Intergenic
1048347393 8:133586865-133586887 CCCAGTATCAGAAATCTGTCAGG + Intergenic
1048412441 8:134189347-134189369 ATTGTTATCAGCAATATGACTGG - Intergenic
1049566693 8:143344005-143344027 ATGATTTTCAGAAATCTCACAGG - Intronic
1051207685 9:14705692-14705714 CTTCTCAGCAGAAATCTTACAGG + Intergenic
1053496099 9:38549181-38549203 CTTGTGATCAGAAGGCTGACAGG - Intronic
1053631311 9:39943002-39943024 CTTCTCAGCAGAAATCTTACAGG - Intergenic
1053774453 9:41520531-41520553 CTTCTCAGCAGAAATCTTACAGG + Intergenic
1054212576 9:62307696-62307718 CTTCTCAGCAGAAATCTTACAGG + Intergenic
1056610672 9:88123951-88123973 CTTGTGATCAGAAGGCTGACAGG + Intergenic
1058042272 9:100315740-100315762 CTTTTTAGCAGAAACCTTACAGG - Intronic
1058288345 9:103207813-103207835 ATTATGATCAGATATCTGAGAGG - Intergenic
1058512503 9:105735623-105735645 CTTCTCAACAGAAATCTTACAGG - Intronic
1060486264 9:124049049-124049071 CTTATTTTTAAAAATCTGATTGG + Intergenic
1187382241 X:18813624-18813646 CTTAAGATCAGAAATAAGACAGG - Intronic
1188573235 X:31614908-31614930 TTTATTATCAGAATTATGAAAGG + Intronic
1188632260 X:32378941-32378963 ATGATTATCATAAATGTGACTGG + Intronic
1189621828 X:42848878-42848900 TTTCTTATCAGAAACCTGAGAGG + Intergenic
1192707307 X:73540561-73540583 ATTCTTATCAGAAATCCTACAGG + Intergenic
1194075598 X:89387755-89387777 CTTTAGATCAGAAATCTGGCAGG - Intergenic
1194389332 X:93296492-93296514 CTTTTTAGTAGAAATCTTACAGG + Intergenic
1194523968 X:94953994-94954016 ATTATTTTCATAAATCTTACTGG - Intergenic
1194848797 X:98846534-98846556 CTTTTTAACAGAAATCATACAGG - Intergenic
1194992558 X:100560531-100560553 CCTATTACAATAAATCTGACTGG - Intergenic
1196184281 X:112728695-112728717 TTTCTTATCAGAGATCTGGCTGG - Intergenic
1199860707 X:151798431-151798453 CCTATGCTCAGAAATCTGTCAGG + Intergenic
1200717010 Y:6558279-6558301 CTTCTCAGCAGAAACCTGACAGG + Intergenic