ID: 951068682

View in Genome Browser
Species Human (GRCh38)
Location 3:18299151-18299173
Sequence CTCAAGCTATTCCAAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 8, 2: 32, 3: 113, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951068678_951068682 11 Left 951068678 3:18299117-18299139 CCAAACATACTGAGAAGAACTAA 0: 1
1: 0
2: 13
3: 83
4: 734
Right 951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG 0: 1
1: 8
2: 32
3: 113
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951068682 Original CRISPR CTCAAGCTATTCCAAAAAAT TGG Intronic
900904703 1:5546682-5546704 CTCAAACATTTTCAAAAAATTGG + Intergenic
904638069 1:31900043-31900065 CTCAAGCTATTTTAAACAAGGGG + Intergenic
905073841 1:35251974-35251996 CTCAAACTCTTCTAAAAAATTGG - Intergenic
905983340 1:42252167-42252189 CTGAAACTATTCCAATCAATAGG - Intronic
906134603 1:43488575-43488597 CACAAACTCTTCCAAGAAATAGG - Intergenic
906836597 1:49089692-49089714 CTGAAACTATTCCAAAAAATTGG + Intronic
907994341 1:59614095-59614117 CTGAAACTATTCCAATCAATAGG + Intronic
908512991 1:64864280-64864302 CTCAAGTGATACCAAAAAAGAGG + Intronic
909083954 1:71149878-71149900 CTGAAACTATTCCAATCAATAGG + Intergenic
909372503 1:74900232-74900254 CTGAAACTATTCCAATCAATAGG - Intergenic
909403950 1:75265202-75265224 TTCAAACTATTCCAGAAAATTGG + Intronic
909644104 1:77897106-77897128 CTGAAACTATTCCAATCAATAGG + Intronic
909841695 1:80335589-80335611 CTCAAACCATTCCAAACAATAGG + Intergenic
909971862 1:82000353-82000375 CTTAGGCTATTCTAAAAGATTGG - Intergenic
910227277 1:84948450-84948472 TGAAAGCTATTCCATAAAATTGG + Intronic
910594958 1:88970878-88970900 CTCATTCTATTCTAAATAATGGG + Intronic
910786235 1:91001132-91001154 CTGAAACTATTCCAATCAATAGG + Intronic
910786673 1:91006488-91006510 CTCAAACTCTTCCAAAAAATAGG + Intronic
912506966 1:110163057-110163079 CTCAAGCTATTCCAAACATGAGG + Intronic
912606693 1:110997988-110998010 CTCAAACTATTCCAAAAAATAGG - Intergenic
912620778 1:111155027-111155049 CTGAAACTATTCCAAAATACTGG - Intronic
913663420 1:121025509-121025531 CTAAAACTATTCCAAAAAATTGG + Intergenic
914014811 1:143808777-143808799 CTAAAACTATTCCAAAAAATTGG + Intergenic
914163010 1:145152430-145152452 CTAAAACTATTCCAAAAAATTGG - Intergenic
914653432 1:149717334-149717356 CTAAAACTATTCCAAAAAATTGG + Intergenic
915043368 1:152987630-152987652 CTCAAACTATTTCAGAAAATTGG + Intergenic
915816045 1:158966323-158966345 CTAAAACTATTCAAAAAACTGGG + Intronic
917449512 1:175135428-175135450 CTCAAACTATTTCAGAAAAGGGG + Intronic
917718584 1:177762977-177762999 CTGAAACTATTCCAATCAATAGG + Intergenic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
919434759 1:197544316-197544338 CTCAAGCCATTCCTATTAATTGG - Intronic
921278968 1:213546677-213546699 CTAAAACTATTCTAAAAATTAGG - Intergenic
921874617 1:220180678-220180700 CTCAAACTATTTCACAACATTGG + Intronic
922302963 1:224319264-224319286 CTCAAATTATTCCCAAAAAATGG + Intronic
922392311 1:225157325-225157347 CTCAACTAATTCCAAAAAAGTGG + Intronic
922460940 1:225813928-225813950 CTCCAGCTACTCCACAAACTAGG + Intronic
1063284330 10:4667410-4667432 CACAAACTCTTCCAAAAAAGTGG - Intergenic
1063340196 10:5255738-5255760 CTGAAACTATTCCAATCAATAGG + Intergenic
1063861536 10:10313411-10313433 CTCACCCTATTCTAAAAACTTGG + Intergenic
1064143506 10:12809388-12809410 ATCTAGCAATTCCAAAAAAATGG + Intronic
1065260168 10:23915652-23915674 CTATAGCTATTCCAAAACAAAGG + Intronic
1066014892 10:31231444-31231466 CTGAAACTATTCCAAACAATTGG + Intergenic
1066110972 10:32196568-32196590 CTCAAACTCTTTCAAAAAAATGG - Intergenic
1067186571 10:44033742-44033764 CTTAGGCTATTCCATAAACTTGG - Intergenic
1067813589 10:49451780-49451802 CTCAAACTCTTTCAAGAAATAGG - Intergenic
1068123663 10:52811539-52811561 CTCAAGGTATGCTAAAAAGTAGG + Intergenic
1068491196 10:57726321-57726343 CTCTGGCTATTCCATATAATAGG - Intergenic
1068642068 10:59420599-59420621 CTCAAACTCTTCCAAAAAATAGG + Intergenic
1068888470 10:62123823-62123845 CAAAAGCTACTCCATAAAATTGG - Intergenic
1069050871 10:63792211-63792233 CTCAAACTACTGCAAAAAATAGG + Intergenic
1069065749 10:63940095-63940117 CTCAATCTTATCTAAAAAATGGG + Intergenic
1069072318 10:64001923-64001945 CTGAAACTACTCCAAAAAATTGG + Intergenic
1070334581 10:75443732-75443754 CTCAAACACTTACAAAAAATTGG - Intronic
1070632868 10:78100252-78100274 CTGAAACTATTCCAAACAATAGG + Intergenic
1071099866 10:82023065-82023087 TTCCAGCTATTTCAAAATATAGG + Intronic
1071212207 10:83356354-83356376 GACAAGGTATGCCAAAAAATAGG + Intergenic
1071784553 10:88884125-88884147 CTCAATTTATTTTAAAAAATTGG + Intronic
1072032356 10:91533230-91533252 CTGAAACTATTCCAATCAATAGG + Intergenic
1072311667 10:94162200-94162222 CTGAAACTATTCCAATCAATAGG - Intronic
1072589463 10:96814883-96814905 CTCAAGAGATTCCAATAATTTGG - Intergenic
1072863080 10:99027558-99027580 TTCAAACTATTCTGAAAAATAGG + Intronic
1074179548 10:111046724-111046746 CTGAAACTATTCCAATCAATAGG + Intergenic
1074274936 10:111992245-111992267 TTCAAGTTAGTCCAACAAATGGG - Intergenic
1074344441 10:112669219-112669241 CTCAAGCTATGGAAAAAATTAGG + Intronic
1074404150 10:113165956-113165978 CTAAAGCTATTCTAAAGACTTGG - Exonic
1076269490 10:129139046-129139068 TTCAAGATATTCAAAAAAATCGG - Intergenic
1077451467 11:2650385-2650407 CTAAGGCTACTCCATAAAATTGG - Intronic
1077949179 11:6936582-6936604 CTCAAACTCTTCCAAAAAATAGG + Intronic
1079814293 11:25036010-25036032 CTGAAACTATTCCAAAAAGCTGG - Intronic
1080083962 11:28256238-28256260 CTCAAACTATTCTAAGAAAGAGG - Intronic
1080317967 11:30971167-30971189 CAAAAGCTAATTCAAAAAATTGG + Intronic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1080914501 11:36642454-36642476 CTGAAACTATTCCAATGAATAGG + Intronic
1082251606 11:49987718-49987740 CACAAGTTTTTCTAAAAAATAGG - Intergenic
1082316045 11:50723693-50723715 CTGAAACTATTCCAATCAATAGG + Intergenic
1082865152 11:57892965-57892987 CTCAAACTATTCCAGAAAATTGG - Intergenic
1082917738 11:58456511-58456533 CTCAAACTATTCCAAAAGATTGG + Intergenic
1083137644 11:60693886-60693908 CCAAAGCAATTTCAAAAAATTGG + Intergenic
1085493449 11:76945338-76945360 CAAAAGCAATTTCAAAAAATTGG - Intronic
1086430704 11:86733177-86733199 CACAAACTCTTCCAAAAAATAGG + Intergenic
1086923953 11:92619401-92619423 CACAAACTCTTCCAAAATATAGG - Intronic
1087442356 11:98202507-98202529 CTGAAACTATTCCAATCAATTGG + Intergenic
1087485167 11:98751433-98751455 CTGAAACTATTCCAAACAATAGG + Intergenic
1087719164 11:101642485-101642507 CTGAAACTATTCCAATCAATAGG + Intronic
1088159544 11:106853771-106853793 CTAAAGCCAGTCCATAAAATTGG - Intronic
1088601824 11:111486470-111486492 TTCATACTATTCTAAAAAATTGG + Intronic
1088899254 11:114102772-114102794 CTAGAGCTATTCCAGAAAAAAGG + Intronic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1090316526 11:125794888-125794910 CTCAAACTATTCTGAGAAATAGG - Intergenic
1091598153 12:1894332-1894354 CTCAAGTTATTCCAAAATATTGG + Intronic
1091810661 12:3394755-3394777 CTGAAACTATTCCAATCAATAGG - Intronic
1091824573 12:3501744-3501766 CTGAAACTATTCCAATCAATAGG - Intronic
1091943496 12:4512337-4512359 CTGAAACTATTCCAATCAATAGG + Intronic
1092325251 12:7524428-7524450 CTGAAACTATTCCAAGCAATTGG - Intergenic
1093285043 12:17248697-17248719 CTCAAACTTGTCCAAACAATTGG + Intergenic
1093992576 12:25606876-25606898 CTGAAACTATTCCAATCAATAGG - Intronic
1094873223 12:34611050-34611072 CTGAAACTATTCCAATCAATAGG - Intergenic
1095228272 12:39702531-39702553 CTGAAACTATTCCAATCAATAGG + Intronic
1095298395 12:40553479-40553501 ATGAAACTATTCCAAAAAATTGG - Intronic
1095314040 12:40737198-40737220 TTCAAGCTATTTGAAAAGATAGG + Intronic
1095780449 12:46053226-46053248 CTGCAACTATTCTAAAAAATGGG + Intergenic
1096346682 12:50853923-50853945 CTAAAACTATTCAAAAAAATTGG + Intronic
1097235495 12:57536641-57536663 CTGAAGCTCTTCCAAAAACAGGG + Intronic
1097291453 12:57919617-57919639 CTCAAGCTAGTTCAAACAAAGGG + Intergenic
1097418866 12:59348922-59348944 CTGAAACTATTCCAAACAATAGG - Intergenic
1097753194 12:63380547-63380569 CTGAAACTATTCCAAACAATAGG + Intergenic
1098053568 12:66479517-66479539 CTGAAACTATTCCAAACAGTAGG + Intronic
1098634237 12:72761503-72761525 CTCAAACTGTTCCAAAATCTTGG + Intergenic
1099733916 12:86541688-86541710 CTAAAGCTATTACAAATGATAGG + Intronic
1099849842 12:88079483-88079505 ATCAAGCTATTACAAAAAACAGG + Intronic
1101028748 12:100639367-100639389 CTGAAACTATTCCAATCAATAGG - Intergenic
1101482656 12:105115591-105115613 CTCAATCAATACCAAAAAAGGGG - Intronic
1104262299 12:127195456-127195478 CTGAAATTATTCCAAAAAAGAGG + Intergenic
1105442626 13:20428117-20428139 CACAATCTCTTCCAGAAAATAGG + Intronic
1107187543 13:37541953-37541975 CTGAAACTATGCCAAAAATTGGG - Intergenic
1108099643 13:46940823-46940845 CTCAAACTGTTGAAAAAAATAGG + Intergenic
1108130541 13:47294967-47294989 CTGAAACTATTCCAAACAATTGG - Intergenic
1108135743 13:47356324-47356346 CTCAAACACTTCCAAAAAATTGG - Intergenic
1108137513 13:47381714-47381736 CTGAAACTATTCCAATCAATAGG + Intergenic
1108168343 13:47715737-47715759 CTGAAACTATTCCAATCAATAGG + Intergenic
1108175201 13:47785349-47785371 CTGAAACTATTCCAATCAATAGG + Intergenic
1109120980 13:58456931-58456953 CTAAACCTATTCCAAAAATAGGG + Intergenic
1109346560 13:61121708-61121730 CTCAAACTTTTCCAAAAATTTGG + Intergenic
1109961215 13:69634512-69634534 CTCAAACTATTCCAAAAAATTGG - Intergenic
1110088580 13:71414504-71414526 TTCAAACTATTCCAAAAAAATGG - Intergenic
1110677800 13:78270659-78270681 CTCATACTCTTCCAAAAACTTGG - Intergenic
1110985377 13:81960628-81960650 CTGAAACTATTCCAAAACAATGG + Intergenic
1111226573 13:85280906-85280928 CTCAAACTCTTGCAATAAATTGG - Intergenic
1111344460 13:86932448-86932470 CTCAATGTAATCCAAAAAACTGG - Intergenic
1111513054 13:89291321-89291343 CTTAAAACATTCCAAAAAATTGG - Intergenic
1111783293 13:92755927-92755949 CTGAAACTATTCCAATCAATAGG + Intronic
1112139888 13:96628383-96628405 CTCAATATATTTCAAAAGATTGG - Intronic
1112619832 13:101043486-101043508 CTGAAGCTACTCCAAACAATAGG - Intergenic
1112814955 13:103263040-103263062 CAGAAGCTATTCTATAAAATTGG - Intergenic
1112860710 13:103826818-103826840 CTGAAACTATTCCAAATAATAGG - Intergenic
1113050700 13:106208440-106208462 CTCAAGTTACTCCAAATATTTGG - Intergenic
1113169810 13:107487823-107487845 CTGAAACTATTCCAAAAAATGGG - Intronic
1114126050 14:19727165-19727187 CTGAAACTATTCCCAAAAATGGG - Intronic
1115013319 14:28577477-28577499 ATCAGGCTATTTCAAAGAATTGG - Intergenic
1115765842 14:36623070-36623092 CACAAACTCTTCCAAAAAATAGG - Intergenic
1115905681 14:38200541-38200563 ATAAAGCAATTCCAAAAGATAGG + Intergenic
1116022877 14:39482992-39483014 CTGAAACTATTCCAATCAATAGG + Intergenic
1116106657 14:40516369-40516391 CTCAAACTATTTCAAAAAACAGG + Intergenic
1116193251 14:41687003-41687025 CTGAAACTATTCCAAACAATTGG - Intronic
1116230349 14:42207446-42207468 CTGAAACTATTCCAATCAATAGG - Intergenic
1116274558 14:42814459-42814481 CTCAAACTCTTCCAAAAAAATGG - Intergenic
1116318209 14:43425459-43425481 CTGAAACTATTCCAAACAATAGG + Intergenic
1116532070 14:45984378-45984400 CTCAAACTCTTCCAATATATTGG - Intergenic
1116579569 14:46622082-46622104 CTGAAACTATTTCAAACAATAGG + Intergenic
1116749199 14:48861636-48861658 CTAAACCTATTCCAATAATTTGG + Intergenic
1116840130 14:49811962-49811984 CACAAACTCTTCCAAAAAATAGG - Intronic
1116960467 14:50963246-50963268 TTCAATCTATTCCAGCAAATGGG + Intergenic
1117086994 14:52211726-52211748 CTGAAACTATTCCAATCAATAGG + Intergenic
1117188654 14:53268953-53268975 CTGAAACTATTCCAATCAATAGG - Intergenic
1117200787 14:53387966-53387988 TTCATTCAATTCCAAAAAATTGG - Intergenic
1117502774 14:56370536-56370558 CTAAAACTATTCCAAAAAATTGG - Intergenic
1119111476 14:71978807-71978829 CTGAAACTATTCCAATCAATAGG - Intronic
1120340962 14:83220568-83220590 CTCAAGCAAGTCCAAAACCTAGG - Intergenic
1121965761 14:98303565-98303587 CTAAAACTATTCAAAAAATTCGG - Intergenic
1123757624 15:23409103-23409125 CTCAATCTATTCTGAAAAACTGG - Intergenic
1125272903 15:37959302-37959324 TTCAAACTATTCCAAAACACAGG + Intronic
1127020295 15:54738954-54738976 CAAAAGCTATTCCATCAAATTGG + Intergenic
1127094973 15:55503372-55503394 CTGAAACTATTCCAATCAATCGG + Intronic
1127763086 15:62159861-62159883 CTCAAGCTATTCTCAAAAAATGG + Intergenic
1128621330 15:69152777-69152799 CTCAACCTATTCCTGAGAATAGG - Intergenic
1130398612 15:83528934-83528956 CTAAAGCCAATCCAAAAAAATGG - Intronic
1131613328 15:93987846-93987868 ATCCAGCTATTCAATAAAATGGG - Intergenic
1131634041 15:94210826-94210848 CTGAAACTATTCCAATCAATAGG - Intergenic
1135296867 16:21287309-21287331 CTCAAACTCTACCAAAAAATAGG - Intronic
1137364573 16:47849518-47849540 CACATGCTGTTCCAAGAAATGGG + Intergenic
1137520884 16:49194471-49194493 CTCTAGCTTTTCTAGAAAATTGG - Intergenic
1137887365 16:52119332-52119354 CAAAAGCTACTCCATAAAATTGG + Intergenic
1139111915 16:63902650-63902672 ATCCAGCTATTCCAAAGAAGTGG + Intergenic
1140883731 16:79223957-79223979 CTGAAACTATTGCAAACAATAGG + Intergenic
1141052121 16:80777792-80777814 CATAAGCTATTCCTAAAAACAGG + Intronic
1142780317 17:2176375-2176397 CCCAAGCATTTCCAAAAGATTGG - Intronic
1144361142 17:14494595-14494617 CACAAACATTTCCAAAAAATTGG - Intergenic
1144615132 17:16763342-16763364 CTCAAGTTTTTCCAGATAATGGG + Intronic
1145003807 17:19324155-19324177 CTCAACAAATTGCAAAAAATTGG + Intronic
1145134804 17:20393398-20393420 CTCAAGTTTTTCCAGATAATGGG + Intergenic
1149675133 17:58453136-58453158 CTTAAACTATTCCAAAAAATTGG + Intronic
1150865800 17:68848558-68848580 CTTAAGCCATTGCAAAAAAATGG + Intergenic
1150930903 17:69584198-69584220 AACAAGCTAATCCAAGAAATAGG + Intergenic
1152553771 17:81042980-81043002 CTCAAGCAATTCCAAGAAGCTGG + Intronic
1153268050 18:3290841-3290863 CTCAAACTATTCTGAAAAATAGG - Intergenic
1153435753 18:5066427-5066449 CTCTCACTGTTCCAAAAAATAGG + Intergenic
1153607226 18:6846725-6846747 CTGAAGCCTTTCCAAAAAATGGG + Intronic
1153657479 18:7296619-7296641 AACAAACTTTTCCAAAAAATAGG - Intergenic
1154230827 18:12554588-12554610 CTCAAACTATTCTGAAAAATAGG + Intronic
1154382337 18:13863812-13863834 CTCGAGCTAGTCAAAAAAAGAGG + Intergenic
1154407869 18:14111869-14111891 CTTAAACTATTCCAAAACAGAGG + Intronic
1155488807 18:26377219-26377241 CACAAGCTCTTCTAAAAAATAGG - Intronic
1156296265 18:35794186-35794208 CTGAAACTATTCCAATCAATAGG + Intergenic
1156606859 18:38676680-38676702 TTGACACTATTCCAAAAAATAGG - Intergenic
1156791029 18:40975491-40975513 CACAAGCTAATCCAAAAAACTGG - Intergenic
1156896453 18:42252243-42252265 CTAAAAGTATTCCAAAAAATTGG - Intergenic
1157178517 18:45474421-45474443 CTGAAACTATTCCAAACAGTAGG - Intronic
1159008676 18:63038133-63038155 CTCTGGCTATCCCAGAAAATGGG + Intergenic
1159560974 18:69994034-69994056 CTCAATACATTCCAAAGAATAGG - Intergenic
1159679570 18:71331137-71331159 CTAAAACTATTCCCAAAATTTGG + Intergenic
1159858893 18:73622555-73622577 CTGAAACGATTCCAAAAAAATGG + Intergenic
1162243228 19:9375388-9375410 CTCAAACTCTTCCAAAAAAATGG - Intronic
1162687933 19:12402976-12402998 CTCAAACTATTCCAAAACAGAGG - Intronic
1163739989 19:19005605-19005627 CTCAAACTACTACAAAAAAGGGG + Intronic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
1163871251 19:19823091-19823113 TTCAATCTATTCCAATACATTGG + Intergenic
1163972397 19:20811272-20811294 CTGAAACTATTCCAATCAATGGG + Intronic
1164450128 19:28354734-28354756 CTCAAACTTTTCCAAAACACTGG + Intergenic
1164508013 19:28875192-28875214 CTCCAGCTATTTCAAGAAAAGGG - Intergenic
1164642202 19:29833990-29834012 TTCATGCTATTACGAAAAATGGG + Intergenic
1167407306 19:49320958-49320980 CTCAAACTTTTCCAAAAAATTGG + Intronic
925506516 2:4571320-4571342 CTCAACATTTTCCAAAAAATTGG - Intergenic
926824309 2:16887379-16887401 CACAAATTCTTCCAAAAAATAGG - Intergenic
926986466 2:18630170-18630192 TTCCAGCTGTTCCAGAAAATAGG - Intergenic
927138907 2:20116372-20116394 CTCCAGCTAATCCATAAAACGGG + Intergenic
928070669 2:28212155-28212177 CTCAAGCTATTCCAACTAACAGG - Intronic
928116882 2:28551452-28551474 CTCACCCTTTTCCATAAAATAGG - Intronic
928414052 2:31076677-31076699 CTCAATCCATTTGAAAAAATTGG + Intronic
928830311 2:35474597-35474619 CTAAATCTTTTTCAAAAAATAGG - Intergenic
928988754 2:37208244-37208266 CTGAAACTATTCCAAAAGATAGG + Intronic
929231348 2:39564158-39564180 CAGAAGCTAATCCATAAAATTGG - Intergenic
929350122 2:40940548-40940570 CCAATGCTATTCCTAAAAATAGG + Intergenic
929401351 2:41585544-41585566 TTGAAACTATACCAAAAAATTGG + Intergenic
929845706 2:45523775-45523797 CACAAACTCTTCCAAAAAACAGG + Intronic
930184810 2:48402860-48402882 TTTCAGCTATTCCAAAGAATAGG + Intergenic
931204342 2:60132737-60132759 CTGAAACTATTCCAATCAATAGG - Intergenic
931506166 2:62929182-62929204 CTCAAACGTTTCCAAAACATTGG + Intronic
931534017 2:63251883-63251905 CTGAAACTATTCCAAAAATCAGG + Intronic
931600437 2:63997245-63997267 CTCAAACTAGTCTGAAAAATAGG - Intronic
931815755 2:65898815-65898837 CAAAAGCTACTCCATAAAATTGG + Intergenic
933078261 2:77956093-77956115 CACAAACTAGTCCAAAAAATAGG + Intergenic
933334104 2:80934103-80934125 CTCAATCATTTCCAAAATATAGG + Intergenic
933617830 2:84501571-84501593 CTCAAACTATTCCAAAAACTAGG - Intergenic
933857494 2:86429750-86429772 CAAAAGCTACTCCACAAAATTGG + Intergenic
934111090 2:88743581-88743603 CTGAAACTATTCCAAAAGATGGG - Intronic
934996311 2:98964210-98964232 CTGAAACTATTCCAAAAATTGGG - Intergenic
936580946 2:113700076-113700098 CTCAAGTGATGCCAATAAATGGG + Intergenic
937188625 2:120070428-120070450 CTGAAACTATTACAAACAATAGG + Intronic
938425657 2:131184678-131184700 CTGAAACTATTCCAAAAAGAGGG + Intronic
938740156 2:134223825-134223847 CTGAAGCTTTACCTAAAAATAGG + Intronic
938852638 2:135276953-135276975 CTCTACCTATTCCATATAATAGG + Intronic
938975388 2:136472288-136472310 CTGAAACTATTCCAATCAATAGG + Intergenic
939018131 2:136925711-136925733 CTTAAACTCTTCCAAAGAATTGG - Intronic
939246598 2:139633072-139633094 CACAAACTATTCTAAAAAGTTGG - Intergenic
939438843 2:142215982-142216004 TTCAAGCTGTTCAATAAAATTGG - Intergenic
939482168 2:142762468-142762490 CTAAAGCAAATTCAAAAAATAGG + Intergenic
941135879 2:161717836-161717858 CTGAAACTATTCCAAACAATTGG - Intronic
941254016 2:163205257-163205279 TTGAAGCTATTCTTAAAAATGGG - Intergenic
941438996 2:165509918-165509940 CTCAAGCTCTTCAAAAAATCAGG - Intronic
942350403 2:175046591-175046613 TTCAAACTATTCCAGAAAATGGG - Intergenic
943557511 2:189423812-189423834 CTCAAACTCTTCCAAAAAATTGG + Intergenic
943624863 2:190187233-190187255 CTCAAGTTATTGCTTAAAATTGG - Intronic
943681673 2:190774791-190774813 CTGAAACTATTCCAATCAATAGG - Intergenic
943964548 2:194316607-194316629 CTCAAACTCATACAAAAAATTGG - Intergenic
943968711 2:194374545-194374567 ATAAAGTTATTCCAAAACATAGG + Intergenic
944737444 2:202580435-202580457 CTGAAACTGTTCCAAAAAATCGG - Intergenic
944954484 2:204792542-204792564 CTCTAGCTATTAAAAAAAAATGG - Intronic
945385680 2:209197498-209197520 TTCAAACTTTTCCAAAACATTGG + Intergenic
945490487 2:210448952-210448974 CTGAAACTATTCCAAACAACAGG + Intronic
945754153 2:213825800-213825822 CTAAAACTATCCCAAGAAATAGG - Intronic
945757939 2:213873103-213873125 CACAAATTCTTCCAAAAAATAGG - Intronic
947322213 2:228933010-228933032 CTGAAACTATTCCAAACAATAGG - Intronic
947882419 2:233529490-233529512 CTCGAGCTAATCCAAGATATGGG - Exonic
948843228 2:240669646-240669668 CACAATCTCTTCCAGAAAATAGG + Intergenic
1169231916 20:3895510-3895532 CTCAAAACATTTCAAAAAATAGG + Intronic
1169980927 20:11383134-11383156 CTAAAACTATTCCAAACAATTGG + Intergenic
1170514062 20:17109547-17109569 ATTAAGCTCTTCCAAACAATTGG - Intergenic
1170576573 20:17667147-17667169 CACAAACTATGCCAAAGAATAGG - Intronic
1170675836 20:18479954-18479976 CTTAAACTGTTCCAAAATATAGG + Intronic
1171362219 20:24595541-24595563 CTGAAACTATTACAAAAAAGTGG - Intronic
1173100874 20:40087292-40087314 CTCAAATTATTCCCACAAATGGG + Intergenic
1173163932 20:40672756-40672778 CTCAGTCTCTTCCATAAAATGGG - Intergenic
1173712184 20:45168620-45168642 CTGAAACTATTCCAAAAAACTGG + Intergenic
1176776166 21:13135360-13135382 CTGAAACTATTCCAATCAATAGG + Intergenic
1177101664 21:16905265-16905287 TTCAATCTGTTTCAAAAAATTGG + Intergenic
1177541321 21:22497077-22497099 CTAAAACTATTCCAAACAACAGG + Intergenic
1177621887 21:23606311-23606333 CTGAAACTATTCCAAAAAATTGG + Intergenic
1182167900 22:28194883-28194905 CTGAAACTATTCCAATCAATAGG + Intronic
1182169505 22:28212726-28212748 CTGAAACTATTCCAATCAATAGG + Intronic
949114578 3:304285-304307 CTGAAACTATTCCAAACAACAGG - Intronic
949746284 3:7296425-7296447 CACAATCTCTTCCAGAAAATGGG - Intronic
950236135 3:11321884-11321906 TTCCAGCTATTCCATAAAAATGG + Intronic
951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG + Intronic
951399951 3:22219927-22219949 CTCAATATATTCAACAAAATGGG + Intronic
951545427 3:23820074-23820096 CTAAAGCTATTCCAGATAGTTGG + Intronic
951654964 3:24996002-24996024 TTCAAACTATTACAAAATATTGG - Intergenic
952066083 3:29572812-29572834 CTCAAACAATTCTGAAAAATAGG - Intronic
952105307 3:30063739-30063761 CTCAAGAGATTCCAGAAAAGTGG - Intergenic
953201839 3:40784725-40784747 CTCAGTCTAGTCCCAAAAATGGG - Intergenic
955797857 3:62656395-62656417 CTCATTTTCTTCCAAAAAATAGG - Intronic
956317797 3:67958250-67958272 CTCAAACTATTCCAAAAAAGTGG + Intergenic
956476438 3:69625733-69625755 CTCAAACTATTCCAAAAAATAGG + Intergenic
957116367 3:76031909-76031931 CTGAAACTATTCCAATCAATAGG - Intronic
957482567 3:80817131-80817153 CTGAACCTATTCCAAAAAAATGG + Intergenic
957505131 3:81109698-81109720 CTCAATATCTTCCAAATAATTGG - Intergenic
957721318 3:84003600-84003622 CTGAAACTATTCCAAAAGACAGG - Intergenic
958005701 3:87808161-87808183 CTCAAACTATTCCAAAAAATTGG - Intergenic
958020706 3:87991735-87991757 CCCAAGCCATGCCAAAAAATTGG - Exonic
958687654 3:97420648-97420670 TTCAAGCTTTTCCTAAGAATGGG + Intronic
958789936 3:98640265-98640287 CTGAAGCTATTCCAAAAGATAGG - Intergenic
959306952 3:104679505-104679527 CTCAAACTATTCTGAAAAAGAGG + Intergenic
959341987 3:105143466-105143488 CTCAAGGTATTCAAAAAAAAAGG - Intergenic
960276899 3:115738919-115738941 CTAAAACTATTCCAAACAATTGG - Intergenic
960308854 3:116096143-116096165 CTGAAGCTCTTCGAAAATATTGG - Intronic
960867383 3:122215625-122215647 CTGATGATATTCCAAAAAGTGGG - Intronic
962038397 3:131678971-131678993 CTGAAACTATTTCAAAAAATTGG - Intronic
963689582 3:148481731-148481753 CTGAAACTATTCCAATCAATAGG + Intergenic
964803805 3:160584750-160584772 CTCAAACTCTTCAAAAAAAAAGG + Intergenic
964884293 3:161464011-161464033 TGAAAGCTATTCCATAAAATCGG - Intergenic
965016520 3:163165515-163165537 CTCAATCTATTCTGAAAAATAGG - Intergenic
965161311 3:165136925-165136947 CTGAAACTATTCCAATCAATAGG - Intergenic
965217317 3:165879980-165880002 CTGAAACTATTCCAATCAATAGG - Intergenic
965223900 3:165962451-165962473 CTGAAACTATTCCAATCAATAGG + Intergenic
965659011 3:171021190-171021212 CTCAAGCTATTTCCAAGGATAGG + Intronic
967203582 3:187098466-187098488 CTGAAACTATTCCAAAAGATAGG + Intergenic
967696624 3:192539693-192539715 CTAAAACTATTCAGAAAAATAGG - Intronic
968004555 3:195231934-195231956 CTCAAACTATTCTGAAAAATAGG - Intronic
968580416 4:1388973-1388995 CACAAACTCTTCCAAAAAATAGG - Intergenic
969405021 4:6985868-6985890 CTCAAGCCATTTTTAAAAATAGG - Intronic
969486863 4:7477212-7477234 CTCAGGCTATTCCCAAGATTTGG - Intronic
970991157 4:22214985-22215007 CCAAAACTATTCCAAACAATAGG + Intergenic
971543763 4:27857854-27857876 CCCAAATTATTCAAAAAAATTGG - Intergenic
971587930 4:28429329-28429351 CTCAAACTATTTTAAAAAATTGG - Intergenic
971656765 4:29357019-29357041 CTCAAACTCCTCCAAAATATTGG - Intergenic
971670852 4:29555346-29555368 CACGAGGTATTCCAGAAAATAGG + Intergenic
971679362 4:29676738-29676760 CTGAAACTATTGCAAATAATAGG + Intergenic
971720666 4:30241337-30241359 CTGAAACTATTCTAAAAGATAGG - Intergenic
972755898 4:42045669-42045691 CTGAAACTATTCCAAACAATAGG + Intronic
972902958 4:43707955-43707977 CTCAAACTTATCCACAAAATTGG + Intergenic
973967380 4:56177561-56177583 CTCAAACTGTTGCAACAAATTGG - Intronic
974265904 4:59585484-59585506 CTGAAACTATTACAAATAATAGG + Intergenic
974342225 4:60628898-60628920 CTGAAACTATTCCAAACAATAGG - Intergenic
974473812 4:62354387-62354409 ATGAAGCTATTACAAAAAAAAGG + Intergenic
974542519 4:63256560-63256582 ATCAAGCTATTTCAAATGATTGG - Intergenic
974885603 4:67813264-67813286 CTGAAGCTACTTCAAACAATTGG + Intergenic
974966292 4:68764530-68764552 CTGAAGCTATTTCAAAAAATTGG + Intergenic
975297896 4:72754980-72755002 CTGAAACTATTCCAGAAAATTGG + Intergenic
976016739 4:80564128-80564150 CTCAACCTATTATAAAAAATAGG + Intronic
976363486 4:84207192-84207214 CTAAAATTATTCCAAACAATAGG + Intergenic
976490418 4:85664055-85664077 CTGAAACTATTCCAATCAATAGG - Intronic
976681436 4:87760492-87760514 CTCAAGATATCTCAAGAAATGGG - Intergenic
977060435 4:92252572-92252594 TTGAAACTATTCCAAACAATTGG - Intergenic
977064035 4:92290929-92290951 CAAAAGCTATTCCGTAAAATTGG - Intergenic
977199868 4:94102492-94102514 CTGAAACTATTCCAATCAATAGG + Intergenic
977934128 4:102781425-102781447 CCCAAGTTGTTCCAAAATATTGG + Intergenic
977994780 4:103488348-103488370 CTGAAGCTATTCCAAATAATAGG + Intergenic
978085565 4:104648529-104648551 CCCAAACTATTCCAAAAAATAGG + Intergenic
978922126 4:114197036-114197058 CTCAAACTATTCTGAAAAATAGG - Intergenic
979291942 4:118988135-118988157 CTCTAGCTATTCAAATAAACAGG - Intronic
980336200 4:131476749-131476771 CTGAAACTATTCCAAACAACAGG + Intergenic
981103425 4:140855211-140855233 GTCCAGCCATCCCAAAAAATTGG + Intergenic
981285208 4:143009617-143009639 CTCAAACTCTTCCAAAATAATGG - Intergenic
981557359 4:146009455-146009477 CTTAAGCTAATCCATAAAGTTGG - Intergenic
981996392 4:150979919-150979941 CTCAAATTATTCCGAAAAATAGG + Intronic
982531794 4:156554438-156554460 CTCAAACTCTAGCAAAAAATTGG - Intergenic
982581855 4:157188644-157188666 CACAAGCAAATTCAAAAAATTGG + Intergenic
983008398 4:162515095-162515117 CCCAAGTTATTCCAAGAAATAGG + Intergenic
983588957 4:169386392-169386414 CACAAGCTGTTCCAAAATAGAGG - Intergenic
983730564 4:170988406-170988428 CTGAAACTCTTCCAAAATATCGG - Intergenic
984101191 4:175488422-175488444 CTGGAACTATTCCAAACAATAGG + Intergenic
984233490 4:177129459-177129481 CAAAAGCAATTTCAAAAAATTGG - Intergenic
984340201 4:178447348-178447370 CTGAAACTATTCCAATCAATAGG - Intergenic
985059295 4:186059823-186059845 GTCAAACCTTTCCAAAAAATGGG - Intergenic
985523369 5:389550-389572 CTCGAGCTTTTCCACAGAATGGG - Intronic
986041759 5:4000550-4000572 TTGAATCTCTTCCAAAAAATAGG + Intergenic
986395731 5:7327841-7327863 CACCAGCTATACCAACAAATGGG + Intergenic
987537935 5:19212084-19212106 CTCAAACTATTCTGAAAAACAGG + Intergenic
987631790 5:20482380-20482402 CTCAAACTATTACAAAAAGTAGG + Intronic
987674541 5:21058659-21058681 CAGAAACTATTCCAAAGAATCGG - Intergenic
988392062 5:30647144-30647166 CTCATACTATTCCACATAATTGG - Intergenic
989069116 5:37491651-37491673 ACCCAGCTATTCCAAAAAAATGG + Intronic
989789204 5:45374596-45374618 CTTAAACTATTCCAAAAACTTGG + Intronic
989815192 5:45727803-45727825 CTAAAGCTATTCAAATACATGGG - Intergenic
990313609 5:54563794-54563816 CTCAAGCTATTTCAAATAGAAGG - Intergenic
990351074 5:54917115-54917137 CCCAAGCTTTTCCCAAAAAATGG - Intergenic
990696060 5:58418653-58418675 CTCCAGCTATTTTAAAAACTTGG + Intergenic
990858762 5:60302212-60302234 CTGAAACTATTCCAAAAAAAAGG - Intronic
990894440 5:60682887-60682909 ATCAAATTATTCCAAAAAAATGG + Intronic
991682497 5:69152829-69152851 CTCAAGCTCTGCCAAAACAATGG - Intergenic
991977144 5:72194580-72194602 GTCATTCTTTTCCAAAAAATGGG + Exonic
992029368 5:72705637-72705659 CACAAACTCTTCCAGAAAATTGG - Intergenic
992756799 5:79914548-79914570 CTGAAACTATTCCAATCAATAGG + Intergenic
992757051 5:79917289-79917311 CTGAAACTATTCCTGAAAATTGG + Intergenic
993205778 5:84876607-84876629 CTCAAACTGTTCCAAAAAATAGG + Intergenic
993758336 5:91760729-91760751 CTTAAGCCCTTTCAAAAAATCGG - Intergenic
994015375 5:94958867-94958889 CTAAAACTATTCCAAACAATAGG + Intronic
994057549 5:95435380-95435402 CTCAAATTATTCCAAAAAGCAGG - Intronic
994434575 5:99710940-99710962 CTGAAACTATTCCAATCAATAGG - Intergenic
994809283 5:104492396-104492418 ATCAAGCTTTTTCAACAAATTGG - Intergenic
994811784 5:104528543-104528565 CTCATGATATTCAAGAAAATGGG + Intergenic
995099972 5:108288359-108288381 CACATGCTATTGAAAAAAATGGG + Intronic
995223421 5:109676868-109676890 CTCCAGCTAGTCCAAAGCATTGG - Intergenic
996121302 5:119675317-119675339 CTCAAACTATTCCAAAAAATTGG - Intergenic
996130281 5:119773126-119773148 CTGAAACTATTCCGAACAATAGG + Intergenic
996274142 5:121644154-121644176 TTGAAACTATTCCAAAAATTTGG + Intergenic
996446277 5:123555271-123555293 CTCAAGTTCATCCAAAATATCGG + Intronic
997075666 5:130673032-130673054 CTAAAGCAATTACAATAAATAGG + Intergenic
998927102 5:147138511-147138533 CTGAAACTATTCCAAACAATAGG - Intergenic
999350788 5:150869523-150869545 TTGAAACTATTCCAAAAGATAGG - Intronic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
1000238503 5:159386838-159386860 CAAAAGCAATTTCAAAAAATTGG - Intergenic
1000497714 5:162006431-162006453 CTTCAGCTATTCCAACAACTGGG - Intergenic
1001252765 5:170160349-170160371 TACAAGCGATTTCAAAAAATAGG + Intergenic
1003468797 6:6409302-6409324 CTCATGATATGCCAACAAATAGG - Intergenic
1003601793 6:7524474-7524496 CTCATACTATTCAAAAACATGGG + Intergenic
1004749589 6:18548071-18548093 CTGAAACTATTCCAATCAATAGG - Intergenic
1004983747 6:21057066-21057088 CTGAAACTATTCCAAACAACTGG - Intronic
1005208188 6:23429220-23429242 ATGAAACTATTCCAAACAATAGG - Intergenic
1005362725 6:25046951-25046973 CTGAAACTATTCCAAAAAACTGG + Intergenic
1005907956 6:30281719-30281741 CTCAAGCTATTGAAAAATAGAGG - Intergenic
1006278991 6:33031459-33031481 CACAAGCGATTCCAAAAGACGGG - Intergenic
1008641708 6:53469869-53469891 CTGAAACTACTCCAAAAAATAGG - Intergenic
1009558460 6:65206482-65206504 CTGCAACTATTCCAAAAATTTGG + Intronic
1009748370 6:67849787-67849809 CTTAAAACATTCCAAAAAATTGG + Intergenic
1010069726 6:71729276-71729298 CTAAAGCTATTACATAAATTTGG - Intergenic
1010304106 6:74297710-74297732 TTCAAACTCTTCCAAAAAAGTGG + Intergenic
1010426486 6:75733932-75733954 CTCCAACTATTCCAACAACTGGG - Intergenic
1011377329 6:86703638-86703660 CTGAAACTATTCCAAACAGTTGG - Intergenic
1011694192 6:89897419-89897441 CTCAAGTTATTCTAAAACAGTGG - Intergenic
1011876964 6:91973676-91973698 CTGAAACTATTCCAATCAATAGG + Intergenic
1012220332 6:96641240-96641262 CTGAAACTATTCCAATCAATAGG + Intergenic
1012253381 6:97005025-97005047 CTAAAACTATTCAAAAACATTGG - Intronic
1012673963 6:102091657-102091679 CTGAAACTATTCCAATCAATAGG + Intergenic
1012795924 6:103761292-103761314 TTCAAACTCTTCCAAAAGATTGG + Intergenic
1012875246 6:104718882-104718904 TTCAAGTTATTCCATAAAAGAGG - Intergenic
1013895597 6:115084164-115084186 CTGAAACTATTCCAATCAATAGG + Intergenic
1013964530 6:115938924-115938946 CTGAAACTATTCCAAACAATAGG + Exonic
1014058127 6:117040311-117040333 CTGAAACTATTCCAAACAATAGG - Intergenic
1014643927 6:123950345-123950367 CTCAAACTGTTTTAAAAAATTGG - Intronic
1014658503 6:124136453-124136475 CTGAAACTATTCCAAAAGATGGG + Intronic
1014703563 6:124719217-124719239 CCCAACCTATTCCATAAAATTGG + Intronic
1014997764 6:128172859-128172881 ATCAATATATTCCAAAGAATGGG + Intronic
1015032473 6:128612159-128612181 CTCTAACTCTTCCAGAAAATTGG - Intergenic
1015900140 6:138056556-138056578 CTAAAACTATTCCAAAAGATAGG + Intergenic
1016133938 6:140514300-140514322 ATCAAACTCTTCCAGAAAATAGG - Intergenic
1016252542 6:142062274-142062296 CTCAAGCTATTCTAATAGAAAGG - Intronic
1016612299 6:146004538-146004560 CTCAAACTATTTTGAAAAATAGG + Intergenic
1016660822 6:146577564-146577586 CTAAAACTACTCAAAAAAATAGG + Intergenic
1016726655 6:147378173-147378195 CACAAACTCTTCCAAAAGATAGG + Intronic
1019087645 6:169495867-169495889 CTCCAACTTTTCCAAAAACTGGG + Intronic
1021465740 7:20941624-20941646 CTCAAACTTTTCCAAAAAAATGG + Intergenic
1022262746 7:28722176-28722198 CTATAGCTTTTCCAAAAAGTGGG + Intronic
1022431352 7:30325064-30325086 CTCTAGATATTCCAAAACCTAGG + Intronic
1023016572 7:35973983-35974005 TACAAGATATTCCAAAAAAAAGG + Intergenic
1024106435 7:46092414-46092436 CTGAAACTATTCCAGAAAATTGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1025616214 7:63119690-63119712 CCCAAACTCTTCCAAAGAATTGG + Intergenic
1028013370 7:85677486-85677508 CTGAAACTATTCCAATCAATAGG - Intergenic
1028300385 7:89192600-89192622 CTGAAACTATTCCAGAAAATTGG + Intronic
1028306491 7:89271613-89271635 CTGAAACTATTCCAATCAATAGG - Intronic
1028406563 7:90481549-90481571 CTCAATTTTTTCCATAAAATTGG - Intronic
1028560602 7:92170810-92170832 CTCAACAAATTCAAAAAAATTGG + Intronic
1028645000 7:93086377-93086399 CAAAAGCTACTCCATAAAATTGG - Intergenic
1029901257 7:104042355-104042377 CACAAACTCTTCCAAGAAATAGG - Intergenic
1030245495 7:107380756-107380778 CCGAAACTATTCCAAACAATAGG + Intronic
1031377326 7:121043388-121043410 ATCATGCTATTCCATAAGATTGG - Intronic
1031518935 7:122738723-122738745 GACAAGCTCTTTCAAAAAATGGG + Intronic
1032272887 7:130427621-130427643 CTTAAGGTATTCCAAAATAGAGG + Intronic
1032761019 7:134941993-134942015 CTCAAGTTCTTCTACAAAATTGG - Intronic
1032931144 7:136672921-136672943 CGAAAGCTAGTCCATAAAATTGG - Intergenic
1033272273 7:139943283-139943305 ACCCAGCTATTCCAGAAAATGGG - Intronic
1033525957 7:142213770-142213792 CTGAAACTATTCCAAACAAGAGG + Intronic
1033560295 7:142524431-142524453 CTCGGTTTATTCCAAAAAATGGG + Intergenic
1033726169 7:144120758-144120780 CTGAAACTATTCCAATCAATAGG + Intergenic
1035554845 8:559341-559363 CTGAAACTATTCCAAACAATTGG + Intergenic
1035959070 8:4116799-4116821 CTAAAACTACTCTAAAAAATAGG + Intronic
1036185415 8:6618673-6618695 AACAAGCTATTTCCAAAAATAGG + Intronic
1036730879 8:11263398-11263420 CACAAACTTTTCCAAAAAACGGG - Intergenic
1036731453 8:11269249-11269271 CCCAAGCTGTTCCAAGAATTTGG + Intergenic
1037402865 8:18510372-18510394 CTCAAGATGTTCCATGAAATCGG + Intergenic
1037428071 8:18778997-18779019 CTCAAACTATTCCGAAAAATTGG - Intronic
1037939012 8:22936553-22936575 CTCAAACTCTTCCAAAACATTGG + Intronic
1039222897 8:35355212-35355234 CTCAAGTTGTTCAAAAAAAAGGG - Intronic
1039289587 8:36079477-36079499 CTGAAACTACTCCAAAAAATTGG + Intergenic
1039678724 8:39704157-39704179 CTGAAACTATTCCATAAAATTGG + Intronic
1039761071 8:40575674-40575696 TGAAAGCTATTCCATAAAATTGG + Intronic
1040684740 8:49858265-49858287 CTCAATTTCTTCCAAAAAATTGG - Intergenic
1040836676 8:51738835-51738857 CACAATCTCTTCCAAGAAATAGG + Intronic
1041296403 8:56361898-56361920 CAAAAGCAATTTCAAAAAATTGG - Intergenic
1041630241 8:60079436-60079458 CTGAAACTATTCCAAACAATAGG - Intergenic
1041771498 8:61477343-61477365 CTGAAACTATTCCAATCAATAGG - Intronic
1041823563 8:62066362-62066384 CTCAAACTATTCAGAAAAATAGG + Intergenic
1041885611 8:62804210-62804232 CTGAAACTATTCCAATCAATAGG + Intronic
1041886489 8:62815317-62815339 CTGAAACTATTCCAATCAATAGG + Intronic
1041996339 8:64064006-64064028 CTCAAACTCTTCAAAAAAGTTGG + Intergenic
1042038361 8:64563340-64563362 CTGAAACTATTCCAAACAATAGG - Intergenic
1042070480 8:64927985-64928007 CTGAAACTATTCCAAACAATTGG - Intergenic
1042644646 8:70973009-70973031 TTGATGCTATTCCAAAAGATAGG - Intergenic
1042649361 8:71023238-71023260 TGCAAGCCAATCCAAAAAATTGG - Intergenic
1042687202 8:71455355-71455377 CTGAAACTATTCCAATCAATAGG + Intronic
1042901174 8:73729455-73729477 CTCAAACTCTTCCAAAAAATTGG - Intronic
1044007064 8:86950686-86950708 CTCAAACTATTCTGAAAAACAGG - Intronic
1044236642 8:89838908-89838930 CTAAATATTTTCCAAAAAATAGG + Intergenic
1044877016 8:96679466-96679488 CTCAAACTATTCAAAAAAATTGG - Intronic
1046047637 8:108983158-108983180 CTGAAACTATTCCAATCAATAGG - Intergenic
1046298322 8:112252134-112252156 CTCTTGCTCTTCCCAAAAATGGG + Intronic
1046744293 8:117860494-117860516 CTAAATCTATTTCAAATAATTGG + Intronic
1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG + Intergenic
1048563497 8:135568281-135568303 CTGAATTTATTCTAAAAAATAGG + Intronic
1048626637 8:136192744-136192766 CTGAAACTATTCCAATCAATAGG - Intergenic
1048713768 8:137243961-137243983 CTGAAACTATTCCAATCAATAGG + Intergenic
1050141236 9:2518135-2518157 CTGAAACTATTCCAAACAATAGG - Intergenic
1050221425 9:3394926-3394948 CTCAAGCTATTTAAAAAGTTGGG - Intronic
1050517283 9:6458051-6458073 CTGAAACTATTCCAAACAACAGG - Intronic
1050927288 9:11280394-11280416 CTCAGGGTACTCCAAAAAATAGG + Intergenic
1050927691 9:11286466-11286488 CTGAAACTATTCCAATCAATAGG + Intergenic
1051793874 9:20841270-20841292 CTTAAACTATTACAAAAAATAGG - Intronic
1051803806 9:20968001-20968023 CTCAATTTCTTTCAAAAAATAGG - Intronic
1051998721 9:23250364-23250386 CTGAAACAATTCCAAACAATAGG + Intergenic
1052061211 9:23963245-23963267 CTGAAACTATTCCAAACAGTGGG - Intergenic
1052092817 9:24350302-24350324 TTCAAACCATTCCAGAAAATAGG + Intergenic
1052094319 9:24366120-24366142 CTGAAACTATTTCAAAAAACTGG - Intergenic
1052152655 9:25137740-25137762 CCCAAATTATTCCAAAAATTTGG + Intergenic
1052458088 9:28727200-28727222 CCCAAACTATTCCAAAGAATAGG + Intergenic
1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG + Intergenic
1052667681 9:31515920-31515942 CTGAAACTATTCCAAATAATAGG - Intergenic
1052696508 9:31885702-31885724 TTGAAACTATTCCAAATAATAGG - Intergenic
1053098525 9:35349911-35349933 CTCAAGTTAATCCTAAAAGTGGG - Intronic
1055014321 9:71599423-71599445 CTGAAACTATTCCAATCAATAGG + Intergenic
1055194036 9:73564655-73564677 TTTAATTTATTCCAAAAAATGGG - Intergenic
1055367596 9:75561957-75561979 CTGAAACCATTCCAAAAAATTGG - Intergenic
1055911423 9:81356782-81356804 CCCAAACTGTTCCAAAAAATAGG + Intergenic
1056003200 9:82239543-82239565 CTCAAACTATTCCAAACAAGAGG - Intergenic
1056994149 9:91440058-91440080 CCTAAACTCTTCCAAAAAATAGG - Intergenic
1058071284 9:100603032-100603054 CTTAAGATATGCCAACAAATGGG - Intergenic
1058258124 9:102795081-102795103 ATCAAGCAATGCTAAAAAATAGG - Intergenic
1058925006 9:109654930-109654952 CCAAAGCTTTTCCAGAAAATTGG - Intronic
1059255295 9:112924694-112924716 CTCAATCTTTTCCAAATTATGGG + Intergenic
1059714938 9:116904995-116905017 CTCATTCTCTGCCAAAAAATAGG - Intronic
1059999342 9:119944140-119944162 CTCAAGCTATTTCAAAGAAGAGG - Intergenic
1062553284 9:137100299-137100321 TTCAACCTATTCAAAAAATTAGG - Intronic
1187412196 X:19061247-19061269 CTAGAGATATTCCAAAAAGTGGG - Intronic
1188393379 X:29649195-29649217 CTCAAGCTATTACAAAAAATTGG + Intronic
1188560900 X:31467709-31467731 CTGAAACTATTCTAAACAATAGG - Intronic
1188725213 X:33574460-33574482 CTGAAACTATTACAAAAAATTGG - Intergenic
1189581344 X:42410245-42410267 CTGAAACTATTCCAAAATATTGG - Intergenic
1189599923 X:42613195-42613217 CTCAAGCTATTCTATATGATAGG - Intergenic
1190040324 X:47066098-47066120 CATAAACTCTTCCAAAAAATTGG + Intergenic
1190800804 X:53786933-53786955 CTGAAACTATTCCAATCAATAGG + Intergenic
1191132981 X:57034599-57034621 CTGAAACTATCCCAAACAATAGG - Intergenic
1191188945 X:57644907-57644929 CTCAAACTAAGTCAAAAAATAGG + Intergenic
1191196380 X:57728025-57728047 CTGAAACTATTCCAATCAATAGG - Intergenic
1191749340 X:64524572-64524594 CTGAAACTACTCCAAAAATTTGG + Intergenic
1192293158 X:69818814-69818836 CTGAAACTATTCTAAACAATTGG + Intronic
1192806025 X:74510033-74510055 CACAAACTCTTCCAAAAAATTGG - Intronic
1192857919 X:75033776-75033798 CTGAAACTATTCCAAACAATAGG - Intergenic
1193001079 X:76563139-76563161 CTGAAACTATTCCAATCAATAGG + Intergenic
1193011892 X:76685876-76685898 CTGAAATCATTCCAAAAAATGGG - Intergenic
1193079024 X:77387003-77387025 CTCAAACTATTCCAAAAAATAGG + Intergenic
1193252112 X:79303365-79303387 CTAAAACCATTCCAAAAAAGTGG + Intergenic
1193661539 X:84264368-84264390 CTGAAACTATTCCAATCAATAGG - Intergenic
1193830604 X:86284645-86284667 CTCAAACAATTCTGAAAAATAGG - Intronic
1193908948 X:87278905-87278927 CTGAAACTATTCCAATCAATAGG + Intergenic
1194016895 X:88633778-88633800 CTCAAACTATTCCAAAAAAATGG + Intergenic
1194203862 X:90987095-90987117 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1194437475 X:93885698-93885720 CTGAAACTATTCCAATCAATAGG - Intergenic
1194439083 X:93907157-93907179 CTCAAACTATTCTAAAAAATAGG - Intergenic
1195122462 X:101769323-101769345 ATCAAACTACTGCAAAAAATGGG - Intergenic
1195586432 X:106570385-106570407 CTGAAACTATTCCAAGAAATTGG + Intergenic
1195629509 X:107040182-107040204 CTCAAACATTTCCAAAATATTGG + Intergenic
1195982997 X:110600419-110600441 CTCAAACTATTCTGAAAAATAGG - Intergenic
1196507894 X:116470215-116470237 ATGAAGCTACTACAAAAAATTGG - Intergenic
1196615173 X:117759724-117759746 CTGAAACTATTCCAATCAATAGG - Intergenic
1197366505 X:125570307-125570329 CTGAAACTATTCCAAAAAAATGG + Intergenic
1197402979 X:126015373-126015395 CTCAAACTATTACAAAAATAGGG - Intergenic
1198579909 X:138051926-138051948 CTGAAACTATTTGAAAAAATTGG + Intergenic
1198989920 X:142500659-142500681 CTCAAGCTTTTCTCACAAATTGG - Intergenic
1199133391 X:144221828-144221850 CTCAGCCTATTTCAAAAGATTGG - Intergenic
1199841865 X:151657403-151657425 CTGAAACTATTCCAATCAATAGG - Intronic
1200549699 Y:4562544-4562566 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1201974747 Y:19836646-19836668 CTGAAACTATTCCAATCAATAGG - Intergenic
1201992098 Y:20038386-20038408 TTAAAACTATTTCAAAAAATTGG + Intergenic