ID: 951069609

View in Genome Browser
Species Human (GRCh38)
Location 3:18311704-18311726
Sequence GTACTCTGTCCTGTCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951069607_951069609 19 Left 951069607 3:18311662-18311684 CCACTGAACTGGAAAAGAACACT 0: 1
1: 0
2: 0
3: 26
4: 271
Right 951069609 3:18311704-18311726 GTACTCTGTCCTGTCTGCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951069609 Original CRISPR GTACTCTGTCCTGTCTGCCC TGG Intronic
902232182 1:15035075-15035097 CCACGCTGTCCTGTTTGCCCAGG - Intronic
902582433 1:17416597-17416619 GTACTCTATCCGCTGTGCCCGGG + Exonic
902609302 1:17587987-17588009 GTTCCCTCTCCTGTCTGCCTTGG + Intronic
903225864 1:21894022-21894044 GTCCCCTGTCCTCCCTGCCCTGG - Intronic
906167211 1:43695582-43695604 GGACTCTGACCTGTCTTCACTGG + Intronic
908930161 1:69308417-69308439 GTTCTCTTGCCTGACTGCCCTGG + Intergenic
911069973 1:93824857-93824879 GCACTTTGTTCTGTGTGCCCAGG + Intronic
912449922 1:109762373-109762395 GTACTCTGTATCCTCTGCCCAGG + Intronic
916627428 1:166573229-166573251 TTCCTCTGTCTTGTCTTCCCTGG - Intergenic
922614099 1:226951035-226951057 ATACGCTGGCCTGTCTGCCCCGG - Intronic
922801106 1:228365133-228365155 GTGCCCTGCCCTGCCTGCCCTGG - Intronic
1064176136 10:13076869-13076891 CTACTCTGTCCTGTCTCCATTGG - Intronic
1064176998 10:13083792-13083814 CTACTCTGTCCTGTCTCCATTGG - Intronic
1065849786 10:29778184-29778206 GTACTCTGTGATGGCAGCCCTGG + Intergenic
1067201895 10:44180041-44180063 GTACTTTGTCATGGCAGCCCCGG + Intergenic
1070334026 10:75438796-75438818 GTATTCTGACCTGTCTGCACAGG - Intronic
1070736547 10:78867212-78867234 GGACACTGTCCTGTCTGCCCCGG - Intergenic
1070968119 10:80542320-80542342 GTCCTCAGTCCTGTGTCCCCTGG - Intronic
1071512465 10:86271005-86271027 GTACTCTGTCCTGTGAACTCTGG - Intronic
1072625183 10:97106754-97106776 GACCTCTGGCCTGTCTGCTCAGG - Intronic
1072659698 10:97356216-97356238 GGTCACTGTCCTGTCAGCCCAGG - Intergenic
1072664563 10:97384259-97384281 GGCCTCTGTCCTGGCTGCCAAGG - Intronic
1076799885 10:132816107-132816129 GTATTTTGTCCTTGCTGCCCAGG + Intronic
1077226307 11:1440408-1440430 GGACTCTGCCCTGCCTGCTCTGG - Intronic
1077371024 11:2181724-2181746 GGCCTCTGTTCTGTCTGCCAAGG + Intergenic
1077867976 11:6238987-6239009 GCACTCTGCCCTGTCTCCCAGGG - Intronic
1080110981 11:28567547-28567569 GAACTGTGTCCTATGTGCCCCGG - Intergenic
1080853798 11:36094127-36094149 GGACTCGCCCCTGTCTGCCCAGG + Intronic
1081412140 11:42772521-42772543 GTACTGTGTCTTGTCAGTCCTGG + Intergenic
1082682052 11:56186510-56186532 GTACTCTGTCCTGCAAACCCTGG + Intergenic
1084092603 11:66888481-66888503 CTCCTCTGTGCTGGCTGCCCAGG - Intronic
1089099111 11:115945979-115946001 CTTCTCTCTCCTGTCTGCTCAGG - Intergenic
1089692797 11:120197362-120197384 CTCCTCTGCCCTTTCTGCCCAGG - Intergenic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1091160825 11:133418163-133418185 ATACTCTCGCCTGTCTGCCATGG + Intronic
1094579847 12:31724429-31724451 CCACCCTGCCCTGTCTGCCCAGG - Intronic
1095456150 12:42388202-42388224 CTACTGTCTCCTGCCTGCCCTGG + Intronic
1095954967 12:47800659-47800681 GTTCTGTGTCCTGGCTTCCCGGG + Intronic
1101043004 12:100776247-100776269 GTCCTATGTCCTGGATGCCCAGG + Intronic
1102437574 12:112937373-112937395 GTCCTCTCTCCTGTCTGCTCCGG - Intergenic
1103455301 12:121060520-121060542 GAACTCAGTAGTGTCTGCCCCGG + Intergenic
1103728763 12:123012478-123012500 CAACTCTGACCTGCCTGCCCAGG + Intronic
1104013875 12:124949902-124949924 GTGCTTTGTCCTGGCAGCCCCGG + Intronic
1105030214 12:132877473-132877495 GTGCTCTGTGCTGTGTGCCACGG - Intronic
1105792480 13:23816043-23816065 GTAATGTGTCTTTTCTGCCCTGG + Intronic
1106999578 13:35527382-35527404 GGACTCTCCCCTTTCTGCCCAGG + Intronic
1108587570 13:51883730-51883752 GGACTCATCCCTGTCTGCCCAGG + Intergenic
1109659503 13:65439528-65439550 TTACTCTTGCCTGACTGCCCTGG - Intergenic
1110057091 13:70986815-70986837 GGACTCACTCCTGTCTGCCTAGG - Intergenic
1112300332 13:98224190-98224212 GTACTTTGTTATGGCTGCCCTGG - Intronic
1113517225 13:110913226-110913248 GGATTCTGTCCTTTCTACCCTGG - Intronic
1114665274 14:24373956-24373978 GTCCTGTGCCCTGTCTGTCCTGG + Intronic
1115777500 14:36731818-36731840 GTACTCTGTCCTGTGGACTCTGG + Intronic
1115874779 14:37848187-37848209 TGACTCTGACCTGTCTGCCCTGG - Intronic
1117740757 14:58816896-58816918 GCACTCTGCCCTGTCTGCCAAGG + Intergenic
1121587043 14:95069564-95069586 GGACTCTGTTCTGTCTCCCACGG - Intergenic
1121752864 14:96372788-96372810 GTACTCTGTCCTAGCTGCCTTGG - Intronic
1122026316 14:98880102-98880124 CTGCTCTGTCCACTCTGCCCTGG + Intergenic
1122284199 14:100641121-100641143 GGACTGTGTCCTCTCTGCCCAGG - Intergenic
1122284207 14:100641161-100641183 GGACTGTGTCCTCTCCGCCCAGG - Intergenic
1122284215 14:100641201-100641223 GGACTGTGTCCTCTCCGCCCAGG - Intergenic
1122284223 14:100641241-100641263 GGACTGTGTCCTCTCCGCCCAGG - Intergenic
1122284231 14:100641281-100641303 GGACTGTGTCCTCTCCGCCCAGG - Intergenic
1122284238 14:100641321-100641343 GGACTGTGTCCTCTCCGCCCAGG - Intergenic
1122401633 14:101470810-101470832 GTCCTCTGTGCTTTCTTCCCAGG - Intergenic
1122625795 14:103084827-103084849 GGTCTCTGTCCTGGCTGCCCTGG + Intergenic
1122872639 14:104647467-104647489 GTACTGTGTCCTGTCTCCATTGG + Intergenic
1122884948 14:104706831-104706853 GGACTGTGGCCTGTCTGCCAGGG - Intronic
1123193661 14:106595505-106595527 GGACTCTCCCCTGTCTGCCTAGG - Intergenic
1123202284 14:106677731-106677753 GGACTCTCCCCTGTCTGCCTAGG - Intergenic
1127186828 15:56489120-56489142 GTGCTGTGTCCCTTCTGCCCTGG + Intergenic
1127382822 15:58444449-58444471 GTCCTCTGTCCTGGCAGTCCTGG - Intronic
1127386964 15:58474720-58474742 GTTCCCTGGCCTCTCTGCCCAGG + Intronic
1127749865 15:62025104-62025126 GTACTGTGTGCTTTGTGCCCAGG - Intronic
1128117502 15:65119954-65119976 CCATTTTGTCCTGTCTGCCCAGG - Exonic
1131400527 15:92122008-92122030 GTCCTCTCTCCTTTCTCCCCTGG - Intronic
1131412671 15:92223396-92223418 GTACTCTGTCCTTTCTTTCTTGG - Intergenic
1132867007 16:2098055-2098077 GGGCTCTGTCCTGTCTGCTGAGG - Intronic
1134524767 16:14935067-14935089 GGGCTCTGTCCTGTCTGCTGAGG + Intronic
1134548139 16:15125878-15125900 GGGCTCTGTCCTGTCTGCTGAGG - Intronic
1134712356 16:16333554-16333576 GGGCTCTGTCCTGTCTGCTGAGG + Intergenic
1134720214 16:16376847-16376869 GGGCTCTGTCCTGTCTGCTGAGG + Intergenic
1134844473 16:17428299-17428321 GTCCTCTGTCCTCACTGTCCTGG - Intronic
1134947213 16:18335038-18335060 GGGCTCTGTCCTGTCTGCTGAGG - Intronic
1134954472 16:18375140-18375162 GGGCTCTGTCCTGTCTGCTGAGG - Intergenic
1135050450 16:19188622-19188644 GTACTCTGTTATGGCAGCCCTGG - Intronic
1135623722 16:23977470-23977492 GTTCTCAGTCCTGGCTCCCCAGG - Intronic
1136146178 16:28317824-28317846 GTACCCTGGCCACTCTGCCCCGG - Intronic
1136374704 16:29858732-29858754 CTCCTCTGTCCTGCCTACCCTGG - Exonic
1136417646 16:30113442-30113464 GTACTATGCCCTCCCTGCCCTGG - Exonic
1137484908 16:48882700-48882722 GCCCTCTCTCCTGTCTGTCCTGG - Intergenic
1137511866 16:49107609-49107631 GTCCTCTGTCTGGACTGCCCAGG - Intergenic
1137768026 16:50992793-50992815 ATACTCTGCCCTGCCTGACCCGG + Intergenic
1141462044 16:84183478-84183500 GGACCCTGGCCTGACTGCCCGGG - Exonic
1141571838 16:84938886-84938908 GTACACGATTCTGTCTGCCCAGG - Intergenic
1143353559 17:6307552-6307574 GTTCTTTGTCCTGCCTGCTCTGG - Intergenic
1144947826 17:18978792-18978814 GATCTCTGTGCTGTCTGGCCAGG - Exonic
1145729002 17:27158377-27158399 GTACTCTCGCCTGTCTTCTCTGG - Intergenic
1147166520 17:38596334-38596356 AATCTCTATCCTGTCTGCCCTGG - Intronic
1147758586 17:42783542-42783564 GCACGGTGTCCTGTCTGCCTGGG + Intronic
1149576861 17:57719995-57720017 GCACTCTGCCCAGTTTGCCCAGG + Intergenic
1151403426 17:73871173-73871195 CTTCTCCCTCCTGTCTGCCCTGG + Intergenic
1152336426 17:79701968-79701990 GGACCCTTTCCTGTCTGCGCTGG - Intergenic
1152885180 17:82845324-82845346 CCTCTCTGTCCTGTCTGGCCTGG + Intronic
1157559507 18:48636719-48636741 GTCCTATGTCTTGTCTGCCTGGG + Intronic
1159814620 18:73057603-73057625 GTACTTTGTCATGGCTGCTCTGG + Intergenic
1159983418 18:74813543-74813565 CTACTCTGTCCCATCAGCCCAGG + Intronic
1160592803 18:79953170-79953192 ATCATCTGTCCTCTCTGCCCTGG + Intergenic
1161292501 19:3502604-3502626 GTCCTGTGTCCTCTGTGCCCAGG - Intergenic
1161785866 19:6325185-6325207 GTGCTCTGTCCTGAGAGCCCTGG - Intronic
1162191009 19:8946861-8946883 GTACTCTGTGCTGTAGCCCCAGG + Exonic
1162500220 19:11049162-11049184 GCACTGTGTCCTCTCTGCCTGGG - Intronic
1162969496 19:14171704-14171726 ATGCTCTCTCCTGGCTGCCCTGG - Intronic
1163120929 19:15217292-15217314 GTTCTCTGTCCTGTCTTCTCAGG + Intergenic
1165196895 19:34111125-34111147 GTACTCTGCCCAGATTGCCCAGG + Intergenic
1166354789 19:42220527-42220549 GCACTCCTTCCTGTGTGCCCTGG + Intronic
1166698005 19:44865249-44865271 ACTCTCTGTCCTCTCTGCCCAGG + Exonic
1167884144 19:52486616-52486638 CCACTCTGCTCTGTCTGCCCTGG - Intronic
1167889588 19:52528659-52528681 CCACTCTGCTCTGTCTGCCCTGG - Intronic
1167894670 19:52571268-52571290 CCACTCTGCTCTGTCTGCCCTGG - Intronic
1167898739 19:52602192-52602214 CCACTCTGCTCTGTCTGCCCTGG - Intronic
1167903158 19:52637367-52637389 CCACTCTGCTCTGTCTGCCCTGG + Intronic
1167909332 19:52689471-52689493 CCACTCTGCTCTGTCTGCCCTGG + Intronic
1167913843 19:52724764-52724786 CCACTCTGCTCTGTCTGCCCTGG + Intronic
1167915046 19:52734018-52734040 CCACTCTGCTCTGTCTGCCCTGG + Intronic
1167921347 19:52785760-52785782 CCACTCTGCTCTGTCTGCCCTGG + Intronic
1167934175 19:52892839-52892861 CCACTCTGCTCTGTCTGCCCTGG + Intronic
1167937851 19:52922396-52922418 CCACTCTGCTCTGTCTGCCCTGG + Intergenic
1167940350 19:52941662-52941684 CCACTCTGCTCTGTCTGCCCTGG + Intronic
1167946368 19:52992329-52992351 CCACTCTGCTCTGTCTGCCCTGG + Intergenic
1167964410 19:53131942-53131964 CCACACTGCCCTGTCTGCCCTGG + Intronic
1167991823 19:53366697-53366719 CCACTCTGCTCTGTCTGCCCTGG - Intronic
1167995215 19:53396147-53396169 CCACTCTGCTCTGTCTGCCCTGG - Intronic
1167997211 19:53415671-53415693 GTACTCTGTCTAGTCTCACCAGG + Intronic
1167999473 19:53432943-53432965 CCACTCTGCTCTGTCTGCCCTGG - Intronic
1168003845 19:53469704-53469726 CCACTCTGCTCTGTCTGCCCTGG - Intronic
925696121 2:6580993-6581015 ATTCTCTGTTCTGTCTTCCCTGG - Intergenic
926231195 2:11005443-11005465 GGACACTGTCTTGCCTGCCCAGG - Intergenic
928644844 2:33341117-33341139 GTACTCTGCTCTCTCTGCCCTGG - Intronic
929782575 2:44966495-44966517 GTCCTCTGTCCTGACTACCAAGG - Intergenic
931362361 2:61588696-61588718 ATACTCTGTCCTGAGTTCCCAGG - Intergenic
931376724 2:61714419-61714441 GTTCTCTGTGCTGTCTGACGTGG + Intergenic
931790344 2:65658771-65658793 GTGCTCTCTCCTCTCTGTCCAGG + Intergenic
932330964 2:70898059-70898081 TTTCTCTTCCCTGTCTGCCCCGG - Intergenic
934718991 2:96559836-96559858 GTACTTTGTCATGGCAGCCCTGG + Intergenic
934781523 2:96972320-96972342 GTATTCTGTCCTGTCTGCAGGGG - Exonic
934844624 2:97654943-97654965 GTACTGAGGCCTGTCTGCCAAGG - Intergenic
935816527 2:106851206-106851228 GTTCTCTGCCCTTTCTGGCCAGG + Intronic
935845583 2:107162774-107162796 TTGCTCTGTCCTTTCTGCCTGGG + Intergenic
935900375 2:107785822-107785844 AAACTCTATCCTGTCTTCCCAGG + Intergenic
938164800 2:129017303-129017325 GTTCTCTGTTCTGTCTTCCTTGG + Intergenic
938255335 2:129854988-129855010 GTACTTTGTTATGTCAGCCCTGG - Intergenic
939731193 2:145786511-145786533 TTTCTCTGGCCTGACTGCCCTGG - Intergenic
945986838 2:216361630-216361652 GAACTCTGTCCTCTCTTCCTTGG - Intronic
946334148 2:219026285-219026307 GTTCTCTGCACTGTCTTCCCAGG - Intronic
946787499 2:223263259-223263281 TCCCTCTGTGCTGTCTGCCCTGG + Intergenic
947912005 2:233807744-233807766 GTGCTTTGGCCTGTGTGCCCGGG + Exonic
948852503 2:240715345-240715367 GTCCTGTGTCCTGCCTTCCCAGG + Exonic
1172009574 20:31838558-31838580 GAACCCTGTTCTGTCTGACCTGG - Intergenic
1172707537 20:36893364-36893386 AAACTCTGTCCTGTTTTCCCAGG + Exonic
1172894546 20:38291340-38291362 GTCTCCTGTCTTGTCTGCCCAGG - Intronic
1173427642 20:42956683-42956705 CTCCTCTGCCCTTTCTGCCCAGG - Intronic
1173464530 20:43270522-43270544 AGACTTTGTCCTATCTGCCCTGG - Intergenic
1175668167 20:60877944-60877966 GGACTCTGTCCTTTTTGCCAAGG - Intergenic
1175762364 20:61570353-61570375 GCACTCTTTCCTGTCTGGCCTGG - Intronic
1181922160 22:26328884-26328906 GCTCTCAGTCCTGGCTGCCCAGG + Intronic
1182253072 22:29017317-29017339 GTACACTGTCCAGTCTGCCACGG + Intronic
1182918625 22:34059202-34059224 CTACTGTGTCCTGTCTCCACTGG - Intergenic
1183714746 22:39527090-39527112 CTGCTTTGTCCTGTCGGCCCTGG + Intergenic
1184393313 22:44218203-44218225 ATGCCCTGTCCTGTCTGCTCTGG + Intronic
1184504667 22:44893557-44893579 TTACTGGGTCCTGCCTGCCCTGG + Intronic
1184912895 22:47548011-47548033 TCACTCTGGCCTGTCCGCCCTGG + Intergenic
951069609 3:18311704-18311726 GTACTCTGTCCTGTCTGCCCTGG + Intronic
952851365 3:37732510-37732532 GTCCTCTTACCTGTCTTCCCAGG + Intronic
952898389 3:38094327-38094349 GGACTCTGTCATCTCTCCCCCGG + Intronic
953497163 3:43397748-43397770 GTACTCTGTCCTGTGAACTCTGG + Intronic
955997447 3:64691589-64691611 GTACTATGTCCTCTCTGATCCGG + Intergenic
956430282 3:69179373-69179395 GTACTCTGTCTGTTCTGCCCAGG + Intronic
956477045 3:69633361-69633383 GTTCTCTTGCCTGACTGCCCTGG + Intergenic
960871920 3:122258751-122258773 GTTCTCTGCCATGTCTGCCATGG + Intronic
961417086 3:126767071-126767093 GTACTCTGTCCGCCGTGCCCGGG + Intronic
961456686 3:127028099-127028121 GCCCTCTGTCCTGGGTGCCCTGG + Intronic
965704187 3:171489534-171489556 ATACACAGTCCTGTCTGGCCTGG + Intergenic
965924319 3:173958718-173958740 GGACTCTCCCCTTTCTGCCCTGG + Intronic
967891949 3:194369855-194369877 GTACCCTGTAGTGTCAGCCCGGG - Intergenic
969703296 4:8779377-8779399 GTGCCCTGTCCATTCTGCCCCGG - Intergenic
970970413 4:21976768-21976790 CTACTCTATCATGTCTGCTCAGG - Intergenic
971345986 4:25812288-25812310 GTCATCTCTCCTGTCTCCCCAGG + Intronic
972110933 4:35559368-35559390 GTACTTGCTCCTGTCTGCCTAGG - Intergenic
974068819 4:57105620-57105642 GTTATTTGACCTGTCTGCCCAGG - Intronic
976559567 4:86485997-86486019 GTATTCTGTCATGGCAGCCCAGG + Intronic
977916482 4:102600059-102600081 GTTCTCTGTCCTGTCATCTCTGG - Intronic
979637971 4:122978593-122978615 GGACTCACTCCTTTCTGCCCAGG + Intronic
980865211 4:138546334-138546356 TTTCTCTGGCCTGACTGCCCCGG - Intergenic
981450866 4:144896169-144896191 GGGCTCTGTTCTGTTTGCCCAGG - Intergenic
982663554 4:158233629-158233651 GAAATCTCTCCTGTCTGCCCTGG + Intronic
985541006 5:487605-487627 GTACTTTGTCATGGCGGCCCTGG + Intronic
986406161 5:7426983-7427005 GTACTTTGTTCTGGCAGCCCTGG - Intronic
986790466 5:11154655-11154677 GTACTCGGTTCTGACAGCCCTGG - Intronic
987189458 5:15459772-15459794 CTACTCTGATTTGTCTGCCCAGG + Intergenic
987713321 5:21532887-21532909 GTATTCTGTCTTCTCTGACCAGG + Intergenic
988778081 5:34495283-34495305 GTACTTTGTTCTGGCAGCCCTGG + Intergenic
989420366 5:41231764-41231786 GTTCTGTGTCCTGTCTTGCCTGG + Intronic
990805928 5:59661850-59661872 GCATTCTGTCCTGTTTGCCTGGG + Intronic
999233104 5:150073950-150073972 GTACTCTGTCCCCTCTGGCCCGG + Intronic
999364455 5:151012918-151012940 GTACTCTGCACGGTCTGCCCAGG - Intergenic
1000188799 5:158887995-158888017 GTCCTTTCTCCTGTTTGCCCTGG - Intronic
1001650370 5:173311460-173311482 TTACTCTGTCCTGTCTCTTCTGG - Intergenic
1002292674 5:178210316-178210338 CTACACTGTCCTGCCTCCCCTGG - Intronic
1003005200 6:2374859-2374881 GCTCTCTGTCCTGTGTGCGCTGG + Intergenic
1003273727 6:4630081-4630103 TTACTGTGTCCTGTCTCCACTGG + Intergenic
1006755161 6:36409341-36409363 GTTCTCTGTGCTTTCTGTCCTGG - Intronic
1009003396 6:57749001-57749023 GTATTCTGTCTTCTCTGACCAGG - Intergenic
1009426490 6:63519462-63519484 GTACTATGTCCTGTCTTACCAGG + Intergenic
1012924407 6:105253120-105253142 GTACTCCCTCCTGTCTTCCTTGG - Intergenic
1014638486 6:123879362-123879384 ATATTCTGTCCTGTATGTCCTGG + Intronic
1018648954 6:165974973-165974995 GTATTCTTTCCTGGCTGCGCAGG + Intronic
1018918740 6:168156025-168156047 GGACTCTGTCCTGGGTTCCCGGG + Intergenic
1019307249 7:341616-341638 GCATTCTGTCCTGTCTCCTCGGG - Intergenic
1019742022 7:2679813-2679835 AGACTCTGTCCTTTCTTCCCTGG - Intronic
1021270058 7:18574544-18574566 GTACCCTCCCCTTTCTGCCCAGG + Intronic
1021692965 7:23248022-23248044 GACCTCTGTCCTTCCTGCCCGGG + Intronic
1025956539 7:66187460-66187482 GTACCCTGTACTGTCTGATCAGG - Intergenic
1028629675 7:92921206-92921228 TTTCTCTTTCCTGACTGCCCTGG + Intergenic
1033535170 7:142305698-142305720 GAAATCTGTCCTGTCTCCTCTGG - Intergenic
1036181444 8:6588772-6588794 CTCCTCTCTCCTCTCTGCCCAGG + Intronic
1036679934 8:10864544-10864566 GCACTCTCTCTTGTCTCCCCTGG + Intergenic
1037107318 8:15125325-15125347 GGACTATGTCCTCTCTGACCTGG + Intronic
1037891741 8:22627322-22627344 GGACTCTGTCACATCTGCCCTGG + Intronic
1045320802 8:101080346-101080368 GTCCCCTGACCTCTCTGCCCTGG - Intergenic
1048513085 8:135079873-135079895 GTACTCAGTCCTGCATGCCCTGG - Intergenic
1048846281 8:138606273-138606295 GTCCTCAGTTCTGTCTGCTCAGG - Intronic
1049308784 8:141922397-141922419 GGACTCTGTCCAGCCTTCCCGGG - Intergenic
1049311354 8:141935500-141935522 GTGCCTTGTCCTGGCTGCCCTGG - Intergenic
1049715549 8:144088598-144088620 CTACTGTGTCCTGTCTGCATTGG + Intergenic
1050337143 9:4600652-4600674 GTACTCAGTCTTTTGTGCCCAGG - Exonic
1051366976 9:16328248-16328270 GGACTCTGTCCTCCCTGACCTGG - Intergenic
1052091566 9:24334959-24334981 CTCCTCTGTCCTGTCTGCCCTGG + Intergenic
1052966585 9:34345069-34345091 GTACTCTGTCCTCTCAGACCAGG + Intergenic
1056287872 9:85109573-85109595 ATACTCTTTCCTGTTTTCCCAGG + Intergenic
1060255212 9:122021329-122021351 GTACTCTGTCCTGAGAACCCTGG - Intronic
1061147408 9:128808073-128808095 GCACTCTGCCCTCTTTGCCCAGG + Exonic
1061180440 9:129022334-129022356 GTTCTTGGTGCTGTCTGCCCGGG + Exonic
1189272310 X:39760041-39760063 GGTCTCTGTCCTGTGTGCCCAGG - Intergenic
1189839843 X:45063563-45063585 GGAGTCCGTCCTGCCTGCCCTGG + Exonic
1190227670 X:48558875-48558897 GCACTTTGTTCTGTTTGCCCAGG + Exonic
1190706164 X:53030034-53030056 GCCCTCTGTCCTGGCTGCTCAGG + Intergenic
1195810062 X:108819068-108819090 TTACTCTTTCCTGATTGCCCTGG + Intergenic
1195978747 X:110556448-110556470 TTTCTCTTTCCTGGCTGCCCTGG + Intergenic
1196387962 X:115178775-115178797 GTACTTTATGCTGTGTGCCCTGG - Intronic
1197818985 X:130527615-130527637 GTACTTTGTCATGGCAGCCCTGG - Intergenic
1198405866 X:136311747-136311769 CTACTGTGTCCTGACTGCCCTGG - Intronic