ID: 951073967

View in Genome Browser
Species Human (GRCh38)
Location 3:18366805-18366827
Sequence ATTTACAGGTGGCATATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951073967 Original CRISPR ATTTACAGGTGGCATATAAT GGG (reversed) Intronic
905992209 1:42347874-42347896 AATTGCAGCTGGTATATAATTGG + Intergenic
908659403 1:66421078-66421100 ATTTCCATGTGGTATTTAATGGG + Intergenic
908694967 1:66829302-66829324 TTTTGTAGGTAGCATATAATTGG - Intronic
910264021 1:85319699-85319721 ATTCACAGGATGCACATAATTGG + Exonic
912611102 1:111045195-111045217 ATTTACTGATGGTATATAAAAGG - Intergenic
915536400 1:156538696-156538718 CTTTGAAGGTGGCATATAAATGG - Intronic
919411961 1:197257002-197257024 GTTTGCAGATGGCATATCATGGG - Intergenic
921005209 1:211086341-211086363 ACTTCCAAGTGGGATATAATTGG - Intronic
923236406 1:232037429-232037451 ATTGAAAGGTGGCATATCACTGG - Intronic
1063269508 10:4491347-4491369 ATTTGCAGGTTGCATAGCATTGG - Intergenic
1064223855 10:13465088-13465110 ATTCACTGCTGGCACATAATAGG + Intronic
1064940518 10:20729995-20730017 TTTTACAGGTAGCATAGAGTAGG - Intergenic
1065082829 10:22144087-22144109 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1067950324 10:50729342-50729364 ATTTACAGTTGACAAAAAATTGG - Intergenic
1068482787 10:57615297-57615319 GTTTACATGTTGCATAAAATGGG - Intergenic
1068500720 10:57837984-57838006 ATTTTCTTGTGGCATTTAATGGG - Intergenic
1070855541 10:79605675-79605697 ATTTCCTGATGGCATTTAATGGG - Intergenic
1070885658 10:79894557-79894579 ATTTACAGTTGACAAAAAATTGG - Intergenic
1071686654 10:87765104-87765126 ATTTATGGGTGAGATATAATGGG + Intronic
1071898704 10:90094525-90094547 GTTTGCAGATGGCATATTATGGG - Intergenic
1071924790 10:90393596-90393618 ATTTACAAGTTGCATATTTTGGG - Intergenic
1072338530 10:94422894-94422916 ATTTATTGTTAGCATATAATAGG + Intronic
1074091873 10:110267773-110267795 ATTTACTGCTAGCATATATTGGG + Intronic
1079053631 11:17186026-17186048 AGTTACAGGAGGGAGATAATGGG - Intronic
1080353366 11:31411805-31411827 ATTTACAGGTACCAGATATTGGG + Intronic
1084142936 11:67245751-67245773 ATTTTCAGTTGGCCTATACTTGG - Intronic
1085696306 11:78707657-78707679 TTTTACAGGTTGAATAGAATAGG - Intronic
1085956095 11:81397260-81397282 AGTTACAGGTAGCATATTAGGGG - Intergenic
1086056196 11:82649913-82649935 ACTTGCAGATGGCATATCATGGG + Intergenic
1087075409 11:94123477-94123499 ATTTCCTGGTGGTATTTAATGGG - Intergenic
1090139441 11:124238993-124239015 TTTCACAGGTGTTATATAATTGG + Intergenic
1092900501 12:13055474-13055496 ATTTACAGTTGCCATATATTTGG + Intronic
1093855595 12:24098480-24098502 ATTTACAGGTGGAGTCTATTGGG - Intergenic
1095740516 12:45601867-45601889 AATTACAGTTGGCATTTACTGGG + Intergenic
1096663480 12:53145507-53145529 GCTTACAGATGGCATATCATGGG - Intergenic
1096906182 12:54937873-54937895 GTTTACAGGTGGCCTATTGTGGG + Intergenic
1097126007 12:56775906-56775928 ATTTCCAGATGTCATATAGTTGG + Intronic
1099219322 12:79893590-79893612 ATTTACAGGTGACAAAGTATTGG - Intronic
1099918652 12:88928953-88928975 AATTATATGTGGCATATAGTTGG + Intergenic
1100035542 12:90246844-90246866 ATTTATAAGTGTTATATAATTGG + Intergenic
1102563492 12:113779272-113779294 ATGTACAGGTAGAAGATAATGGG - Intergenic
1105762915 13:23530125-23530147 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1105936851 13:25108348-25108370 ATTTACAGATGGTCTAGAATAGG - Intergenic
1109793984 13:67286033-67286055 AATTAAAGGAGCCATATAATGGG + Intergenic
1110613349 13:77513842-77513864 TTTTGCAGGTGGCCTATCATGGG - Intergenic
1110664194 13:78096592-78096614 ATTTGCAGATGGCATATTGTAGG + Intergenic
1111097797 13:83537398-83537420 ATTTTCAGGTGTCTTGTAATGGG - Intergenic
1111708828 13:91785326-91785348 AATTACTAGTGGCATCTAATAGG - Intronic
1112153331 13:96788933-96788955 TTTTATAGGTAGCATATAATTGG + Intronic
1112396936 13:99042122-99042144 ATTTTCTGGTGGCCTTTAATTGG + Intronic
1113392794 13:109914149-109914171 ATTTACACTTTCCATATAATTGG - Intergenic
1113815526 13:113167694-113167716 TTTTATAGGTAGTATATAATTGG + Intronic
1116333739 14:43630369-43630391 ACTTGCAGGTGGCCTATCATGGG - Intergenic
1117670895 14:58104289-58104311 ATTTACATGTGGGATACAAGAGG + Intronic
1120608822 14:86613666-86613688 ATTTAAATGTGGCATACAAAGGG - Intergenic
1120970793 14:90205286-90205308 ATTGACAGGTGGCATCTGAGTGG + Intergenic
1121835709 14:97090262-97090284 GTTTGCAGGTGGCAGATCATGGG - Intergenic
1124984277 15:34590939-34590961 AATTACTAGTGGCATCTAATAGG - Intergenic
1126236547 15:46391662-46391684 ATTTTGAGGTTGAATATAATTGG - Intergenic
1130622161 15:85475051-85475073 CTTTCCAGGTGGTTTATAATTGG + Intronic
1133123794 16:3630870-3630892 TCTTATAGATGGCATATAATTGG + Intronic
1134509974 16:14838282-14838304 GTTAAAAGCTGGCATATAATAGG + Intronic
1134697624 16:16236776-16236798 GTTAAAAGCTGGCATATAATAGG + Intronic
1137241815 16:46661568-46661590 ATTTACAGATGTCAAATAATAGG - Intronic
1140097642 16:71888955-71888977 ATATACAGGAAGTATATAATCGG + Intronic
1140603021 16:76500574-76500596 ATTTACAGGTGAAATATATTTGG - Intronic
1143108003 17:4538989-4539011 ATTTACAAGAGGAATATATTTGG - Exonic
1144419083 17:15079587-15079609 CTTTACAGATGGCATAGCATTGG - Intergenic
1149511807 17:57248372-57248394 ATTTATAGGTGGTTTATGATGGG - Intergenic
1155366800 18:25057021-25057043 ATTTGCAGGTGCTCTATAATGGG + Intergenic
1155577297 18:27261518-27261540 CCTTATAGGTGACATATAATTGG + Intergenic
1156363690 18:36406523-36406545 TTTTACAGGTGACATTTAAACGG + Intronic
1158317457 18:56227433-56227455 ATTTACAGTTGGAAAATAAGAGG - Intergenic
1167779095 19:51584705-51584727 ATATACAAGTGGCCAATAATAGG + Intronic
924966235 2:78873-78895 AATTACAGGTGATATTTAATTGG - Intergenic
927677211 2:25114833-25114855 ATCTACAGGTCGCATGTACTTGG - Intronic
930358891 2:50353317-50353339 ATTAAAAGATGGCATATTATTGG - Intronic
933012685 2:77088204-77088226 ACTTCCAGGTGGCACATAAATGG + Intronic
935857682 2:107293003-107293025 ATTTAAAGGTGAGATATAAAAGG - Intergenic
936802475 2:116285271-116285293 ATTTCCTTGTGGCATTTAATGGG - Intergenic
938050062 2:128161289-128161311 AATTACAGGGGTTATATAATTGG + Intronic
938242536 2:129754518-129754540 ATGTACAGCTGGCATCTAACTGG - Intergenic
939570058 2:143830471-143830493 AGTTCCAGGTGTCATATAACTGG + Intergenic
940092205 2:149933401-149933423 ATTTACAGTTGGGAAATGATAGG - Intergenic
940110904 2:150152593-150152615 ATTTCCAGATGTCATATACTTGG + Intergenic
941202602 2:162531008-162531030 ATATACAGGTGGTAAATAATGGG + Intronic
942335159 2:174875851-174875873 ATTTACAGGTGTCATCCAACAGG - Intronic
942478712 2:176358330-176358352 GTTTGCAGGTAGCATATCATAGG + Intergenic
942846011 2:180426320-180426342 ATTTACATGTGGAATTTAAAGGG + Intergenic
943299875 2:186185219-186185241 TTTTATAGATGGCATATACTTGG - Intergenic
943380568 2:187139890-187139912 ATTTACAGGTTGCAGAAATTAGG + Intergenic
944713220 2:202354592-202354614 ACTTGCAGGTGGCCTATCATGGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945798798 2:214398413-214398435 ATATACAGGAGGCATAAAAATGG - Intronic
946206382 2:218111895-218111917 ATTTCCATGTGGTATTTAATGGG + Intergenic
946930613 2:224666776-224666798 ATTTACAGATGGCAGATTGTGGG - Intergenic
947929011 2:233947556-233947578 ATCCCCAGGTGGCATATAAATGG - Intronic
948409961 2:237751722-237751744 TTTTACAGGGTGCAAATAATTGG - Intronic
1170277403 20:14607236-14607258 ATGTAAAGGTGGCATCCAATAGG + Intronic
1171128482 20:22626192-22626214 ATTTACAAGTGGTATGTAATAGG + Intergenic
1173439343 20:43061784-43061806 ATTTGCAGATGGGATTTAATGGG - Intronic
1173527188 20:43742223-43742245 GTTTACAGATGGCAAATCATGGG - Intergenic
1173697048 20:45026772-45026794 ATTCAAAGGTGGCAAATTATGGG + Intronic
1175003416 20:55655292-55655314 ATATACAGTTGGCATTGAATGGG + Intergenic
1178106307 21:29323269-29323291 GCTTGCAGGTGGCCTATAATGGG - Intronic
1183038548 22:35158870-35158892 ATTTAGAGGTGAGAGATAATTGG - Intergenic
1183848261 22:40561614-40561636 CTTTAGAGATGGCAAATAATAGG + Intronic
949485880 3:4537482-4537504 ATTCACAGGTAACATATACTAGG - Intronic
951073967 3:18366805-18366827 ATTTACAGGTGGCATATAATGGG - Intronic
951664010 3:25102081-25102103 ATGTACAGGTGCCATAAATTAGG + Intergenic
951744997 3:25968405-25968427 ATTTACAGATGGCAAATCAGAGG - Intergenic
956493291 3:69797145-69797167 ATTCACATGTGGCATTAAATTGG - Intronic
957135023 3:76275807-76275829 ATTTACAGGTGGGAATTATTAGG - Intronic
957266336 3:77970902-77970924 ACTTGCAGATGGCATATCATGGG + Intergenic
958122748 3:89313243-89313265 TCTTACAGATAGCATATAATTGG + Intronic
959196508 3:103189197-103189219 ATTGGGAAGTGGCATATAATGGG + Intergenic
960642231 3:119836927-119836949 ATGTACAGATGACATACAATTGG + Intronic
963026633 3:140925972-140925994 TCTTACAGGCAGCATATAATTGG + Intergenic
963859184 3:150290293-150290315 CTTTTCAGGTGTCATATAGTTGG - Intergenic
964567630 3:158074933-158074955 AATTACAAGTAGCATATGATAGG - Intergenic
966351158 3:179033615-179033637 ATTTATCTGTGGCATATAAATGG - Intronic
967581457 3:191160633-191160655 ATTAACATGTGCCATATACTGGG - Intergenic
970379013 4:15487551-15487573 TCTTATAGGTAGCATATAATTGG + Intronic
970804866 4:20018809-20018831 ATTTACAGGTCTCATTTAATTGG - Intergenic
971036443 4:22698136-22698158 ATTTATAGTTGGCATCTGATTGG - Intergenic
971874531 4:32289666-32289688 ATTAACAGGTGACATCTTATGGG + Intergenic
972447792 4:39162684-39162706 ACTTTCAGAAGGCATATAATAGG + Intergenic
974526953 4:63058138-63058160 ATTTCCAGGTGGTATTTAATGGG - Intergenic
974989252 4:69063985-69064007 ATTTACAGGAGGCATCAAAGGGG + Intronic
977146020 4:93440783-93440805 ATTTGCAGGTGATATTTAATTGG + Intronic
977623504 4:99164169-99164191 ATTTTCAGGTCTCATATGATAGG + Intergenic
978633825 4:110779992-110780014 ATTTACATGTGTCATATATGTGG - Intergenic
979365004 4:119811433-119811455 TCTTATAGGTAGCATATAATTGG + Intergenic
979950469 4:126886430-126886452 GTTTACAGATGGCAGATAATGGG + Intergenic
981416001 4:144494191-144494213 AATTTCAGGTGGCATGTCATTGG - Intergenic
981455959 4:144953735-144953757 AGATACAGGAGGCATATAAAAGG + Intergenic
981622131 4:146713247-146713269 ATTTAATGTTGGCATATAATTGG + Intronic
981846329 4:149174624-149174646 GTTTGCAGGTGGCATATTGTGGG - Intergenic
981875333 4:149536210-149536232 ATTTACAGTAGGCAGATGATAGG + Intergenic
982574884 4:157097266-157097288 CTCTACATGTGGCATAAAATAGG + Intronic
983769802 4:171535253-171535275 GGTTGCAGGTGGCATATTATGGG + Intergenic
984098465 4:175460632-175460654 ATGTACATCTGGGATATAATTGG + Intergenic
984285318 4:177721460-177721482 ACTCACAGGTGGCATAGATTAGG - Intergenic
986049780 5:4078028-4078050 TTTTACAGGAGCTATATAATGGG + Intergenic
986757756 5:10853987-10854009 AGCTGTAGGTGGCATATAATGGG + Intergenic
987212839 5:15701546-15701568 ATTTACTGGATACATATAATGGG + Intronic
987760454 5:22155351-22155373 AAGGAGAGGTGGCATATAATTGG + Intronic
988412583 5:30906263-30906285 ATTGTCAAGTGGCATATACTTGG - Intergenic
988527137 5:31997115-31997137 ATATACAGTAGGCATATAAAAGG + Intronic
989088722 5:37705888-37705910 ATTTACTGGACACATATAATTGG + Intronic
989758234 5:44982314-44982336 ATTTACATTTGGCATTAAATGGG - Intergenic
989957738 5:50375634-50375656 ATTTCCTTGTGGCATTTAATGGG - Intergenic
990116996 5:52401661-52401683 ATTTACTTGTGGTATTTAATGGG - Intergenic
990733893 5:58839112-58839134 TTTTGTAGGTAGCATATAATTGG + Intronic
994177757 5:96730330-96730352 ATATACATGTGGCATTTAAGTGG - Intronic
995287863 5:110412361-110412383 CTTTACAGTTGGCATATCAATGG - Intronic
997154960 5:131545634-131545656 ATGTACAGGTGTTACATAATTGG + Intronic
997887498 5:137643596-137643618 ATTTTTAGTTGGCACATAATAGG + Intronic
1000580118 5:163026228-163026250 GTTTGCAGGTGGCCTATGATGGG - Intergenic
1000598906 5:163248555-163248577 GTTTACAGATGGCCTATCATGGG + Intergenic
1004615408 6:17283223-17283245 ATCTACAGGTGGCTAAAAATTGG - Intronic
1008292515 6:49734756-49734778 ATTTACAAGTGGTAAATAACTGG - Intronic
1010502602 6:76619273-76619295 ATTTACAATTGGAATATAAATGG - Intergenic
1013996158 6:116310699-116310721 ATTTGATGGTGGCATATACTAGG - Intronic
1015439059 6:133226298-133226320 TTTCACAGGTGGCTTACAATTGG + Intergenic
1015517975 6:134103075-134103097 ATTGGCTGGGGGCATATAATTGG + Intergenic
1016304284 6:142667204-142667226 ATTTTCTGGTGTCATATACTAGG - Intergenic
1016339565 6:143048646-143048668 TTTTCCAGGTGTCATATAGTTGG - Intergenic
1020596735 7:10215589-10215611 ATTTACAGGTTCCAGAGAATAGG + Intergenic
1022582697 7:31571816-31571838 TTTGACAGATGGCATATCATTGG - Intronic
1025250511 7:57348441-57348463 ATTGACAGCTGGCATTTATTGGG - Intergenic
1026433876 7:70376420-70376442 ATTTACAGGTTGTATAAAAATGG + Intronic
1028727553 7:94104910-94104932 TTCTAAAAGTGGCATATAATTGG + Intergenic
1028882584 7:95896635-95896657 GTTTACAGGTGGCATAGTTTAGG - Intronic
1029036864 7:97531770-97531792 GTTTTCAGATGGCATATCATGGG - Intergenic
1030450275 7:109700347-109700369 ATTTGCAGATGGCCTATTATGGG + Intergenic
1030673984 7:112365792-112365814 ATTTACAGATGGCATCAGATGGG - Intergenic
1031561482 7:123243997-123244019 GCTTGCAGGTGGCATATCATGGG - Intergenic
1033807514 7:144971996-144972018 ATTTGCAGGTGGCCTGTCATGGG - Intergenic
1036076341 8:5505669-5505691 TTTTACAGGTATCATATAATTGG + Intergenic
1036436092 8:8734835-8734857 ACTTACAGAAGGCATATAGTTGG - Intergenic
1037187907 8:16087030-16087052 ATTTAAAAGTGCCATAAAATAGG + Intergenic
1040826538 8:51627310-51627332 ATTAACAGGTGAGATTTAATAGG + Intronic
1043003597 8:74790584-74790606 ATTTGCAGATGGCAGATAGTGGG - Intronic
1044293870 8:90504524-90504546 ATTTACCAGTGGCTTACAATTGG - Intergenic
1044956789 8:97489700-97489722 TTTTCCAGGTGTCATATAGTTGG - Intergenic
1045502968 8:102757367-102757389 ATTTACTGGTCACTTATAATCGG + Intergenic
1046432513 8:114147038-114147060 ATTTATAGGTGGAATATATATGG + Intergenic
1047655715 8:126974665-126974687 AATTACAGATGGCATATTGTGGG + Intergenic
1048483843 8:134829420-134829442 CATTATAGGTGGCATATAAGTGG + Intergenic
1050102649 9:2135045-2135067 ACTTGCAGGTGGCATCTCATGGG - Intronic
1050145644 9:2564636-2564658 GCTTACAGATGGCATATTATGGG - Intergenic
1050486730 9:6142288-6142310 ACTTACAAATGGCAGATAATTGG - Intergenic
1051442398 9:17099794-17099816 ATTTGCAGATGGCAAATCATGGG - Intergenic
1051935657 9:22439847-22439869 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1052075313 9:24134499-24134521 CTTTACATGTGCCATATCATGGG - Intergenic
1052180098 9:25515752-25515774 ACTTGCAGATGGCATATCATGGG + Intergenic
1052662739 9:31456574-31456596 ATTTACAGTTAACAAATAATAGG + Intergenic
1052807983 9:33030031-33030053 ATTTTCAGGTGTCATATTAAAGG - Intronic
1053574871 9:39348906-39348928 TCTTATAGGTGGCATATATTTGG - Intergenic
1053620747 9:39812619-39812641 TCTTATAGGTGGCATATATTTGG + Intergenic
1053625964 9:39871310-39871332 TCTTATAGGTGGCATATATTTGG - Intergenic
1053878912 9:42571908-42571930 TCTTATAGGTGGCATATATTTGG + Intergenic
1053893754 9:42722454-42722476 TCTTATAGGTGGCATATATTTGG - Intergenic
1054096436 9:60907596-60907618 TCTTATAGGTGGCATATATTTGG - Intergenic
1054217924 9:62379391-62379413 TCTTATAGGTGGCATATATTTGG + Intergenic
1054232779 9:62529787-62529809 TCTTATAGGTGGCATATATTTGG - Intergenic
1054263416 9:62894823-62894845 TCTTATAGGTGGCATATATTTGG - Intergenic
1055300928 9:74881162-74881184 TCTTACAGGTAGCATATAGTTGG - Intronic
1055303102 9:74902690-74902712 ATTTATAGGTGGCTTGTAATAGG + Intergenic
1058254374 9:102743119-102743141 ATTTGGAGGAGGCATATAAGTGG - Intergenic
1058388737 9:104470342-104470364 ATTTACAAATGGGATAGAATAGG + Intergenic
1058450665 9:105093196-105093218 TCTTACAGGTGGCTTATAGTTGG + Intergenic
1058641549 9:107090906-107090928 TTTTATAGGCAGCATATAATCGG - Intergenic
1058874743 9:109234199-109234221 ATAAACAGGTGGAATATATTTGG + Intronic
1059847562 9:118297709-118297731 ATTTAGAAGGGGCATATGATAGG + Intergenic
1060501486 9:124160373-124160395 TTTTGCAGATGGCATATTATGGG + Intergenic
1060515956 9:124265983-124266005 ATTTGCAGGTGGCATTTTTTGGG + Intronic
1062162132 9:135086638-135086660 ATTTACAGAAGGCTTCTAATCGG - Intronic
1187085844 X:16042847-16042869 ATTTTCGGGTGGCATATTTTTGG - Intergenic
1188746301 X:33848242-33848264 AATTACTGGTGACATGTAATGGG - Intergenic
1189578281 X:42379000-42379022 ATGAATAGATGGCATATAATAGG + Intergenic
1190091600 X:47442650-47442672 TTTTACAGGTAGCATATGGTTGG + Intergenic
1190403043 X:50057962-50057984 AGTAAGAAGTGGCATATAATAGG + Intronic
1192461162 X:71318698-71318720 ATTTAAAAGTGACATATACTGGG + Intergenic
1194870430 X:99124828-99124850 CTTTACAAATAGCATATAATTGG - Intergenic
1196201082 X:112886766-112886788 ATGTTCAAGTGGCATATATTTGG + Intergenic
1196618633 X:117796618-117796640 AGTTACAGCTGGCAAATATTAGG - Intergenic
1196640694 X:118056860-118056882 ATGAACAGCTGACATATAATAGG + Intronic
1198798935 X:140430269-140430291 GCTTACAGATGGCATATCATGGG - Intergenic
1201515629 Y:14816443-14816465 ATTTCCTTGTGGCATTTAATGGG + Intronic
1201671756 Y:16529863-16529885 ATTTACATATGGTATATGATTGG - Intergenic
1202258255 Y:22942608-22942630 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1202411245 Y:24576366-24576388 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1202459536 Y:25093706-25093728 ATTTCCTTGTGGCATTTAATGGG + Intergenic