ID: 951075510

View in Genome Browser
Species Human (GRCh38)
Location 3:18386539-18386561
Sequence GAAGGTTTACCAGCAAAGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951075506_951075510 7 Left 951075506 3:18386509-18386531 CCGGTAACTGCAAGAAATTCTGC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 951075510 3:18386539-18386561 GAAGGTTTACCAGCAAAGACTGG 0: 1
1: 1
2: 0
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951075510 Original CRISPR GAAGGTTTACCAGCAAAGAC TGG Exonic
904166747 1:28561520-28561542 GAAGGTCCACCAGCAAGGAAGGG - Intronic
904450969 1:30611271-30611293 GGAGCTTTACAGGCAAAGACAGG + Intergenic
904599025 1:31663829-31663851 GAATGTTTACCAGAAAAGGCGGG + Intronic
904849513 1:33446811-33446833 GAGGGTTTATCAGCAATGAAGGG + Intergenic
905908825 1:41639936-41639958 AAATGTTTTCCAGGAAAGACAGG + Intronic
908060284 1:60340833-60340855 GAAGCTGCACCAGCAAGGACAGG + Intergenic
910105699 1:83629059-83629081 GAAGGACTACTAGCAAGGACTGG + Intergenic
912531301 1:110324966-110324988 GAAAGTAGACCAGCACAGACTGG - Intergenic
916380648 1:164207237-164207259 ACAGGTTTAGCAGCAAAGACAGG - Intergenic
924227243 1:241932256-241932278 GAAAGTTTACCTGCAGGGACAGG + Intergenic
924685976 1:246290165-246290187 GAGAGTTTTCCAGCAAAAACTGG + Intronic
1063151132 10:3337447-3337469 GAAAGTGTACCAGCAAAAATTGG - Intergenic
1064251109 10:13707171-13707193 GAAAGTTAACCAGCAGAGAGGGG - Intronic
1065944220 10:30592460-30592482 GAATTTTTTCCAGCAAAGAGAGG - Intergenic
1069077988 10:64058446-64058468 GAATGTTTACCACCAAATGCAGG + Intergenic
1072833367 10:98683623-98683645 GGAGGTTTATCAGAAAAGAGAGG + Intronic
1074038052 10:109761072-109761094 AAAGGCTTCCCAGGAAAGACAGG - Intergenic
1075514041 10:123095123-123095145 GAATGTTTTCCAGGAAACACAGG + Intergenic
1076062793 10:127426813-127426835 GAAGGTTTCTGAGCAAAGGCTGG + Intronic
1077790652 11:5436320-5436342 GAAGGTGTTCAAGCAAAGACTGG + Intronic
1080157048 11:29123792-29123814 GAAGGCTTGCCAGCACAGCCTGG + Intergenic
1082097697 11:48144665-48144687 GAAGGGTGACCAGCTAAGAAAGG - Exonic
1083611417 11:64006157-64006179 GAAGGTTTAGCCACAAAGACCGG + Intronic
1085077361 11:73603232-73603254 GCAGTGTTACCAGCAAAGATGGG + Intergenic
1085621031 11:78038145-78038167 GAAAATTGGCCAGCAAAGACAGG + Intronic
1086808545 11:91274470-91274492 GAAGGTTCACCAGCAAAGACTGG - Intergenic
1087076018 11:94128140-94128162 GAAGACTTACCAGCAAAGTTGGG - Intergenic
1088095114 11:106090596-106090618 GAAAGTTTACCAACAAAGAATGG + Exonic
1088561041 11:111116590-111116612 AGAGGTTAATCAGCAAAGACGGG + Intergenic
1091776918 12:3190677-3190699 GAAGGTTTACCAGATAAGAGGGG - Intronic
1099096697 12:78383306-78383328 GAAGGTTTAATAGTCAAGACTGG - Intergenic
1100767548 12:97884530-97884552 GATGGTCTACCAGCCAAGAAGGG - Intergenic
1102131241 12:110530399-110530421 GAACCATCACCAGCAAAGACAGG + Intronic
1104689490 12:130814579-130814601 GAAGGTTTCTCAGCAAAGAAAGG + Intronic
1107845387 13:44507244-44507266 GAAGGGTTAACAGCCAAGAAAGG + Intronic
1108275886 13:48809279-48809301 CAAGGTGAACCAGCTAAGACAGG - Intergenic
1109997935 13:70154279-70154301 GAAGCTTTAACAGCAAACAAAGG - Intergenic
1113381490 13:109809999-109810021 GGATGTTTACCAGGAAGGACAGG + Intergenic
1117456216 14:55899280-55899302 AAAGGTTTACCAGGTAAGATTGG + Intergenic
1117784551 14:59269148-59269170 GAAGGTCTAGCAGAAAAGACAGG + Intronic
1120884494 14:89441286-89441308 GAGGGTTTTCCAGGAGAGACTGG - Intronic
1121222526 14:92297385-92297407 CAAGGTCAACCAGCAAAAACTGG + Intergenic
1121786382 14:96664318-96664340 GAATTTTTACCAGAAAAGGCAGG + Intergenic
1122533693 14:102447010-102447032 GATGGTATTTCAGCAAAGACAGG + Intronic
1127802153 15:62486223-62486245 GAATGTCTGCCAGCAAGGACAGG - Intronic
1128595430 15:68942511-68942533 GAAGCTTTTCCACTAAAGACAGG - Intronic
1132013955 15:98299887-98299909 GAAGGCTTGCCAGCAGAGAGCGG - Intergenic
1132286225 15:100664935-100664957 GAGGGTTTATCAGTAAAGACAGG - Intergenic
1132633894 16:933563-933585 GGGCCTTTACCAGCAAAGACCGG + Intronic
1133460253 16:5981221-5981243 GAAGGGTCAACAGGAAAGACAGG + Intergenic
1134629590 16:15747322-15747344 CAAGGTTCATCAGCAAAAACTGG + Intronic
1140750097 16:78015617-78015639 GACTGTTTACCAGCAACGATGGG - Intergenic
1141148826 16:81550478-81550500 CAAGGTTTCCCAGCCAAGAGTGG - Intronic
1143787593 17:9267578-9267600 GAAGGTTTTCAAGAAAAGCCTGG - Intronic
1144614271 17:16753967-16753989 TAAAGTTTACCAACAAAGAAAGG - Intronic
1144898436 17:18561711-18561733 TAAAGTTTACCAACAAAGAAAGG + Intergenic
1145133939 17:20384010-20384032 TAAAGTTTACCAACAAAGAAAGG - Intergenic
1147154380 17:38536274-38536296 GAAGGGTTAGCAGCACAGGCTGG - Intronic
1147884804 17:43677322-43677344 GAAGGTTGAGGAGGAAAGACTGG + Intergenic
1150089047 17:62304649-62304671 GAAGATTGACCAGCTATGACTGG + Intergenic
1153653733 18:7263800-7263822 GAAGGTCAGACAGCAAAGACAGG + Intergenic
1153675756 18:7454666-7454688 GAAAGTTTCCCAGCAGAGCCTGG + Intergenic
1155997214 18:32342804-32342826 GAAGACTTTGCAGCAAAGACAGG + Intronic
1159032024 18:63241177-63241199 CAAGGATAACCACCAAAGACCGG - Intronic
1160911344 19:1475187-1475209 GCAGCTCTACCAGCAAAGCCGGG - Exonic
1167169325 19:47820771-47820793 GCAGGTTTATCAACAGAGACAGG + Intronic
928936344 2:36682872-36682894 GGAGGTGCACCTGCAAAGACAGG + Intergenic
930114993 2:47710730-47710752 GAGGATTTACCAGCCAAGAAGGG - Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
934050841 2:88209540-88209562 GAAGGTTTTTAAGCCAAGACTGG - Intergenic
939093676 2:137807725-137807747 AAAGGTTTACCAGGTTAGACAGG + Intergenic
939884258 2:147664231-147664253 CAAGCTTTACTAGGAAAGACAGG + Intergenic
940487122 2:154309944-154309966 GAAAGTGTACAAGAAAAGACTGG - Intronic
946094649 2:217262961-217262983 GAAAGCCTAACAGCAAAGACTGG + Intergenic
947174685 2:227352985-227353007 GAAGCCTTACAAACAAAGACAGG - Intronic
948949272 2:241238536-241238558 GATGGTTTTCCAGCAGAGACAGG + Intronic
1168730734 20:78188-78210 AAAAGTTTACCATCAAAGAAAGG + Intergenic
1168911421 20:1450804-1450826 AAATGTTTAACAGCAAGGACTGG + Intronic
1171288860 20:23968172-23968194 GAATCTTTACCAGCAAAGCCTGG - Intergenic
1175565781 20:59975591-59975613 GAAGGATTACCAACAAGGAAGGG + Intronic
1177187686 21:17816410-17816432 GATGATTTGCCAGCAAACACTGG + Intronic
1179222885 21:39425425-39425447 GAAGGTATAATTGCAAAGACAGG - Intronic
1181945235 22:26511843-26511865 GAAGGATTTTCAGAAAAGACGGG + Intronic
1182947205 22:34334566-34334588 CCAGCTTTGCCAGCAAAGACAGG + Intergenic
1183589743 22:38773056-38773078 GGAGGTGTATCAGCAAGGACTGG - Intronic
951075510 3:18386539-18386561 GAAGGTTTACCAGCAAAGACTGG + Exonic
954125719 3:48527063-48527085 CAAGGATTACCAGCAACAACTGG + Intronic
955351397 3:58196126-58196148 GAAGGACTTCCAGCAAAGCCTGG - Intronic
956609992 3:71112783-71112805 GAAAGTTTTCCAACTAAGACTGG - Intronic
957667931 3:83260215-83260237 GAAGGTTTATCAGCAACCACTGG - Intergenic
958907919 3:99962117-99962139 GAAGGTATTCCAGGAAGGACTGG + Intronic
959123860 3:102266328-102266350 GAATGTGTACCAGCAAAGTTGGG + Intronic
961128837 3:124446565-124446587 GAACATTTACCAGCAAAGAGAGG - Intronic
966774595 3:183532827-183532849 GAAGGTTGATGAGCAAAGGCAGG + Intronic
967203276 3:187094724-187094746 CAAAGAATACCAGCAAAGACTGG - Intergenic
970219620 4:13797319-13797341 GAATGTTTACCACCAAAGCAAGG + Intergenic
971390005 4:26176799-26176821 GAAGGTGGTCCAGCCAAGACAGG - Intronic
971481991 4:27123295-27123317 GAAGGTTTCCCAGCAGGGAGAGG - Intergenic
973879717 4:55257188-55257210 GAACCTTGACCAACAAAGACAGG - Intergenic
974802976 4:66842866-66842888 GAAGGTTTACCAGCTTGAACTGG + Intergenic
977147907 4:93469133-93469155 GAAGATTTATCAGAAAAGAATGG - Intronic
977569961 4:98618817-98618839 GAAAATTTACAGGCAAAGACAGG + Intronic
978817530 4:112925907-112925929 GAATGTTTACAAGTAAAGTCAGG + Intronic
978827668 4:113044292-113044314 GAAGGTGGAAGAGCAAAGACTGG - Intronic
980564747 4:134524975-134524997 GAAGATTTATAAGCAGAGACAGG + Intergenic
981666409 4:147231839-147231861 GCAGATATACCAGGAAAGACAGG + Intergenic
981688237 4:147479387-147479409 GAATGTGTTCTAGCAAAGACTGG + Intergenic
984343161 4:178485281-178485303 TAAGGTTTCCAAGGAAAGACAGG + Intergenic
984407888 4:179357097-179357119 CAAGGTTTACCACCAACAACTGG + Intergenic
985032787 4:185807565-185807587 GACGGGGAACCAGCAAAGACGGG - Intronic
989497283 5:42124156-42124178 GAAGGTAGACCAGCTGAGACTGG + Intergenic
990534374 5:56705415-56705437 GAAGGTATTCCAGGAAACACTGG - Intergenic
991734707 5:69621102-69621124 GAAGGTTTACCACCTAAGGGAGG - Intergenic
991780271 5:70125619-70125641 GAAGGTTTACCACCTAAGGGAGG + Intergenic
991811141 5:70476243-70476265 GAAGGTTTACCACCTAAGGGAGG - Intergenic
991859558 5:71001033-71001055 GAAGGTTTACCACCTAAGGGAGG + Intronic
991872718 5:71125930-71125952 GAAGGTTTACCACCTAAGGGAGG + Intergenic
998626218 5:143848741-143848763 GATGGTAGAGCAGCAAAGACAGG + Intergenic
1002573056 5:180154971-180154993 GAAGGTTCAGCAGGAAAGCCAGG + Intronic
1010389145 6:75317536-75317558 CAAGTTTTACTATCAAAGACAGG - Intronic
1011604544 6:89089822-89089844 AAAGGATTACTATCAAAGACTGG + Intergenic
1014564878 6:122935727-122935749 AAAGGTTTACCAGCAAACCATGG - Intergenic
1014757416 6:125316846-125316868 GACGGTTTCCCAGCAATGACCGG + Intergenic
1017952674 6:159149485-159149507 GATGTTTTACCAGCCAGGACTGG + Intergenic
1018200801 6:161393407-161393429 GCATGTATACCAGCAAAGAGAGG - Intronic
1019059542 6:169246200-169246222 GAAGGGTTGCCAGCAAGGCCAGG - Exonic
1020491767 7:8794537-8794559 GAATGTTTTCCATCAAAAACAGG + Intergenic
1024106689 7:46096003-46096025 GAATGTTTTCCTCCAAAGACTGG + Intergenic
1028223617 7:88224199-88224221 GAAGGTGTACCACAAAAGAATGG - Intronic
1031426413 7:121610732-121610754 GGAGGTGTACCAGGAAACACTGG - Intergenic
1039743530 8:40403409-40403431 GAAGGTTTACAGGCAAAGCAAGG + Intergenic
1048574435 8:135679785-135679807 GGAGATTTCTCAGCAAAGACTGG - Intergenic
1050835106 9:10067634-10067656 GAAGGATTACAGGCAAAGAAGGG + Intronic
1050877750 9:10661262-10661284 TATGGTCTAGCAGCAAAGACAGG + Intergenic
1052901972 9:33801116-33801138 GAAGGGTTGCCAGCAGAAACAGG + Intergenic
1057848475 9:98544634-98544656 GGAGGTGTGCAAGCAAAGACTGG + Intronic
1058674522 9:107389119-107389141 GAAGGTGGTCCAGCAGAGACTGG - Intergenic
1058869888 9:109192406-109192428 TAAAGTTCACCAGAAAAGACAGG + Intronic
1060045579 9:120337482-120337504 GAAGGCTTCCCAGGAAAGTCTGG - Intergenic
1187972028 X:24668364-24668386 GAAGACTTGGCAGCAAAGACTGG + Intronic
1188375232 X:29420470-29420492 GAAGGTTGACCAGAAGAGATGGG - Intronic
1189611274 X:42738774-42738796 AAAGTTTGACCAGCAGAGACAGG + Intergenic
1192388460 X:70698676-70698698 GAAGGTTTGACAGCAGAGCCTGG - Intronic
1198456380 X:136821794-136821816 TTACGTTTACCAGCAAAAACTGG + Intergenic