ID: 951075659 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:18388699-18388721 |
Sequence | GCCACAGAACTTTTCACTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 172 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 17, 4: 154} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
951075659_951075661 | 30 | Left | 951075659 | 3:18388699-18388721 | CCTACAGTGAAAAGTTCTGTGGC | 0: 1 1: 0 2: 0 3: 17 4: 154 |
||
Right | 951075661 | 3:18388752-18388774 | ATAATTAAAAAAATTAGATTAGG | 0: 1 1: 2 2: 18 3: 215 4: 2172 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
951075659 | Original CRISPR | GCCACAGAACTTTTCACTGT AGG (reversed) | Intronic | ||