ID: 951075659

View in Genome Browser
Species Human (GRCh38)
Location 3:18388699-18388721
Sequence GCCACAGAACTTTTCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951075659_951075661 30 Left 951075659 3:18388699-18388721 CCTACAGTGAAAAGTTCTGTGGC 0: 1
1: 0
2: 0
3: 17
4: 154
Right 951075661 3:18388752-18388774 ATAATTAAAAAAATTAGATTAGG 0: 1
1: 2
2: 18
3: 215
4: 2172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951075659 Original CRISPR GCCACAGAACTTTTCACTGT AGG (reversed) Intronic