ID: 951076568

View in Genome Browser
Species Human (GRCh38)
Location 3:18400853-18400875
Sequence TTAAGTTACAAGTTGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951076568 Original CRISPR TTAAGTTACAAGTTGGTACA AGG Intronic
903505480 1:23832070-23832092 TTAAGGCACAAGTTGGTGCTAGG + Intronic
909841259 1:80327578-80327600 GTAAGTGAGAAGGTGGTACATGG - Intergenic
911604778 1:99891595-99891617 TTTAATTACAGGTTGGTAAATGG + Exonic
911945589 1:104103849-104103871 TTAAGTAACAAATTGGCAAAGGG + Intergenic
913145056 1:115980843-115980865 TTAAGTGAAAAGATGGTAAAGGG + Intronic
917095955 1:171399027-171399049 TTAAGTGACAAGTAAGTAGAAGG + Intergenic
917264742 1:173208982-173209004 TTAAGGTACAAGTATGTGCATGG - Intergenic
917394023 1:174572192-174572214 TCAAGTTCCAAGATGGTAGAAGG - Intronic
918638255 1:186805966-186805988 TTCAGTTTCAAGGTGGGACATGG + Intergenic
918754728 1:188325067-188325089 TTAAGATATTATTTGGTACAAGG + Intergenic
923831439 1:237562360-237562382 TTAAGTTACAAGAAGCTATAAGG - Intronic
1066690966 10:38027810-38027832 TTAAGTCATAAGCTGTTACAAGG - Intronic
1072776404 10:98200395-98200417 TTAAGTTACAAGTTTGCAGACGG - Intronic
1073091936 10:100948933-100948955 TTGAATTGCAATTTGGTACAAGG + Intronic
1075579773 10:123608532-123608554 TCAAGATAAGAGTTGGTACATGG + Intergenic
1078043284 11:7889030-7889052 TTAAGTTAGTAGTAGTTACATGG + Intergenic
1082752312 11:57032400-57032422 TTAGGATAGAAGTTGGTATAAGG - Intergenic
1094316736 12:29144459-29144481 TTATGTTACCAGTTTGCACAGGG + Intergenic
1097389441 12:58992104-58992126 TTAAGTTACAGTATAGTACATGG + Intergenic
1097409951 12:59239667-59239689 TTAAGTTATAGTTTGGTAAATGG - Intergenic
1097708320 12:62891448-62891470 TTAATTTTCATGTAGGTACATGG - Intronic
1099213679 12:79826792-79826814 TTCACTTACAAGTTGAAACATGG - Intronic
1100682363 12:96940826-96940848 TTAATTTAGAAGTAGATACAAGG - Intronic
1101233732 12:102767363-102767385 TGAAGTCACAAGTAGGAACAAGG + Intergenic
1105046395 12:133007460-133007482 TTAATCTTCAAGTTGGAACAAGG + Exonic
1106851176 13:33794369-33794391 TTATTTTTCAAGTTGGTTCATGG - Intergenic
1109118169 13:58417621-58417643 TTAATTTACAAGGCGGAACATGG + Intergenic
1110838070 13:80107852-80107874 TTAGTTTACAGGATGGTACAAGG + Intergenic
1120116776 14:80627073-80627095 ATAAGTTACACATGGGTACATGG + Intronic
1120277395 14:82394404-82394426 TTATCTTACAAGTTGGTTGAGGG - Intergenic
1120566082 14:86059056-86059078 TTAAGTTACCATATGTTACATGG + Intergenic
1124549715 15:30668360-30668382 TTATGTTAAAAGTGGGTATATGG + Intronic
1125033747 15:35099272-35099294 CTAATTTACGAGTTGGTACATGG - Intergenic
1133928837 16:10215749-10215771 CTATGTAGCAAGTTGGTACAGGG + Intergenic
1135943246 16:26841160-26841182 TTTATTTACATGTTGGTATAGGG - Intergenic
1136001679 16:27299321-27299343 TTAGGATACAACTTGGTACTGGG - Intergenic
1138467878 16:57206440-57206462 TTTTATTACAATTTGGTACAAGG - Intronic
1148144069 17:45350133-45350155 TTATGGTACAAGTGGTTACATGG - Intergenic
1148288401 17:46417551-46417573 TTAAGTGAAAAGTTGGTTAAAGG + Intergenic
1148310569 17:46635136-46635158 TTAAGTGAAAAGTTGGTTAAAGG + Intronic
1151516545 17:74599837-74599859 TTCAGTTACAAGTTGCTGGAGGG + Intergenic
1154542619 18:15559268-15559290 AGAATTTGCAAGTTGGTACATGG + Intergenic
1156365175 18:36419556-36419578 ACAAGTAACAAGTTGCTACAGGG - Intronic
1157004411 18:43564586-43564608 TTAGGTTACAAGATGCTAAAGGG + Intergenic
1157421462 18:47550942-47550964 TTCAGTTAGAAGCTGGTTCAGGG - Intergenic
1159904962 18:74081524-74081546 ATAAGTTTTAAATTGGTACATGG + Intronic
1164719380 19:30421292-30421314 TTAAGATCCAAGTTGGTTAAAGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1168491310 19:56812582-56812604 TTAAGTGACAAGTAGCAACATGG - Exonic
927214831 2:20662419-20662441 TTATGTTCCAAGTTAGTGCATGG + Intergenic
928818351 2:35326126-35326148 TTAAGTCACAAATTGTTACAAGG + Intergenic
930237863 2:48904829-48904851 TTAAATTGCAAGTTGTAACATGG + Intergenic
935796754 2:106649355-106649377 TTAAATTAAAACTTGCTACATGG + Intergenic
936032984 2:109087042-109087064 TTAGGTAGCAAGTTGGGACAGGG + Intergenic
938654738 2:133419482-133419504 TTATGTTCCATGTAGGTACATGG - Intronic
940419032 2:153456668-153456690 TTAATTTACAAGTTGTTATGAGG - Intergenic
941009195 2:160279226-160279248 TTAAGTTACATTTTGGTGCCTGG + Intronic
941499171 2:166248263-166248285 TTTACTTACAAGTTGGTAATTGG - Intronic
942622488 2:177861899-177861921 TTAAGTTAAATTTTTGTACATGG - Intronic
943325749 2:186496057-186496079 GTAAGTTAAAAATTGGTGCATGG - Intronic
945149867 2:206779145-206779167 TTAAGTTAAAAATTGTCACAAGG - Intronic
946570597 2:221020043-221020065 TTAAGTCACATGTTTGTCCATGG - Intergenic
1169995977 20:11557229-11557251 TTAAGTGACAAGATGAAACAAGG + Intergenic
1170660979 20:18339430-18339452 TTAAGTCAAAAATTGTTACAAGG + Intergenic
1172348086 20:34220293-34220315 TTAAGTTAAAAGTAAGCACAGGG + Intronic
1177605589 21:23374044-23374066 TTTAGTGACAAATTGCTACATGG - Intergenic
1178243085 21:30925170-30925192 TTGAGTTATTAGTTGGTTCATGG - Intergenic
1179769210 21:43601618-43601640 TTGAGTTATAAATTGGTAGATGG - Intronic
950342507 3:12259878-12259900 TTCAGGTACAAGTTTTTACATGG - Intergenic
950584975 3:13885895-13885917 TTAATTTACAAGCGTGTACACGG - Intergenic
951076568 3:18400853-18400875 TTAAGTTACAAGTTGGTACAAGG + Intronic
952648190 3:35688135-35688157 TTCAGTGACAAGCTTGTACAAGG + Intronic
953511794 3:43548819-43548841 TTAATTTCCAAGATGTTACAGGG + Intronic
955076451 3:55618116-55618138 TTAATTTGCAAGTTGGTTCAGGG - Intronic
956536650 3:70284322-70284344 TTAGTTTACAACTTGGAACAAGG - Intergenic
958430941 3:94040021-94040043 TTAAGTTATAAGTTGGAACTTGG + Intronic
958540145 3:95460790-95460812 TAAAGTTACAAATTGGTTCTGGG + Intergenic
958784292 3:98580913-98580935 TTAAAGGTCAAGTTGGTACAAGG - Intronic
959301856 3:104612598-104612620 GTAAGTTACAAGTGGGTATTTGG + Intergenic
961604608 3:128084296-128084318 TGAAGTTACTGGATGGTACAAGG + Intronic
963938142 3:151075377-151075399 TTCAGTGACAAGTGGGTAGAAGG + Intergenic
966195803 3:177312775-177312797 ATGAGTTCCAAGTTTGTACATGG + Intergenic
967990531 3:195126970-195126992 TTGAGTTACAGAATGGTACATGG - Intronic
970313584 4:14808281-14808303 TTAAGGTTAAAATTGGTACAAGG - Intergenic
972980990 4:44700952-44700974 ATAAGTTACAAATTGGTTCTTGG + Intronic
977427153 4:96881803-96881825 CTAAAATACAAGTTGGTAAAGGG + Intergenic
978295053 4:107195388-107195410 TTAAAAGACAAGTTGGTAAAGGG + Intronic
982183401 4:152771470-152771492 TTAATTTTCAAGTTTGTTCATGG + Exonic
984551331 4:181163107-181163129 TTAAGATACAAATTGGGAAAAGG - Intergenic
989375933 5:40760467-40760489 TAAAGTTACAAATTTGTATATGG - Intronic
990024698 5:51171879-51171901 TTAAGTTATAAGTTTTTATACGG - Intergenic
990497758 5:56365865-56365887 TAAAGATACAATATGGTACAGGG + Intergenic
991455604 5:66800292-66800314 TTTAGTTACATTTTGGTAGATGG + Intronic
995906153 5:117126275-117126297 TTGAGTTAAAAGTTTGTATATGG + Intergenic
997310895 5:132881655-132881677 TTTAGTTATCAGTTGGTTCATGG - Intronic
998580728 5:143372686-143372708 TTATGTTAAAAGTTGCAACAAGG - Intronic
1001659971 5:173383977-173383999 TTAATTTACAACTTGGTAAGTGG + Intergenic
1004625438 6:17372009-17372031 TTAAGATACAATTGAGTACAGGG + Intergenic
1005626574 6:27668146-27668168 TTAAGTTACAAGTCACTAAAGGG + Intergenic
1006885152 6:37375538-37375560 TTCAGTTCTAGGTTGGTACATGG - Intronic
1008274861 6:49531135-49531157 TAAAGGTAAAAGTTGGTAAATGG + Intergenic
1010664697 6:78615126-78615148 TAAAGTTAAAAATTGATACAAGG - Intergenic
1011492905 6:87910934-87910956 TTAAGTTTCAACTTTGCACAAGG + Intergenic
1011729134 6:90242709-90242731 TTAAGTTACACTTTGGTAGATGG - Intronic
1014875932 6:126659306-126659328 TTAAGTTACTAGTGGGTGCCAGG - Intergenic
1014938891 6:127415249-127415271 TTAAATTACAAGTTGGTCTGCGG - Intergenic
1018183534 6:161245045-161245067 ATAAGTTGCCAGTTGGTGCACGG - Intronic
1018402043 6:163433069-163433091 TTATTTTACATGTTGGTAAAAGG + Intronic
1023487734 7:40704583-40704605 TTATGTTACAGCTTGGCACAGGG + Intronic
1025321135 7:58095397-58095419 TTAATTTACTAGTGGGTATAGGG + Intergenic
1036917972 8:12822518-12822540 TTGAGTTACAAGGTTGTAGAGGG + Intergenic
1037215975 8:16451469-16451491 CTAAGTCCCAAGTTTGTACAGGG + Intronic
1041840214 8:62261119-62261141 ATCAGTTCCAATTTGGTACAAGG - Intronic
1043220913 8:77662493-77662515 TTAAGATACAATTTTGCACATGG - Intergenic
1043649300 8:82568630-82568652 TTTAGTCAACAGTTGGTACAGGG + Intergenic
1044315946 8:90750445-90750467 TTAAGCTACAAGCTAGTAGACGG + Intronic
1046773995 8:118144597-118144619 TTAATTTAAAAATTGGTGCAAGG + Intergenic
1047003961 8:120600630-120600652 TTAAATGACAAATTGATACATGG - Intronic
1051731561 9:20148744-20148766 TAAAGTAACATGTTGGTCCAGGG - Intergenic
1052573196 9:30256442-30256464 CTAATTTACAAGTCTGTACATGG - Intergenic
1056903513 9:90624112-90624134 TTATATTTGAAGTTGGTACATGG + Intronic
1059615258 9:115943850-115943872 TTAAGATACAAATTGGTCCTTGG + Intergenic
1185766059 X:2726832-2726854 TTAAGTTAAAAGCCGGCACAAGG + Intronic
1187722891 X:22170400-22170422 CTAGGTAACAAGGTGGTACATGG - Intronic
1190257478 X:48774351-48774373 GTATGTTACAGGTTGGTAAATGG + Intergenic
1190379295 X:49823233-49823255 TTAAGTTACTTGTTGGTTCTAGG + Intergenic
1190997556 X:55624785-55624807 TAAAGTTAGAGGTGGGTACAGGG + Exonic
1194972582 X:100360271-100360293 TTGAGCAACAAGCTGGTACAAGG - Intronic
1195425078 X:104719685-104719707 TGAAGCTACAAGTTGCAACAGGG - Intronic
1197527045 X:127576414-127576436 TCAAGGTACAATTTGGGACATGG - Intergenic