ID: 951077281

View in Genome Browser
Species Human (GRCh38)
Location 3:18410705-18410727
Sequence CAGTATATGAACACTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951077281 Original CRISPR CAGTATATGAACACTGATGC TGG Intronic
908595061 1:65679181-65679203 CAGTTGATGAGCACTTATGCTGG + Intergenic
908855388 1:68421056-68421078 AAATATATGAACAGTGATGCAGG - Intergenic
908856294 1:68433452-68433474 CAGTATATGAGTACAGATGCTGG + Intronic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
919087177 1:192934171-192934193 AAGAAAATGAAGACTGATGCAGG - Intergenic
1069206108 10:65688172-65688194 CAGTATATGAATCCTGACGATGG - Intergenic
1074336230 10:112578887-112578909 AAGTATATCACCACTGTTGCTGG - Intronic
1074514398 10:114151810-114151832 GAGTATAAGAATAGTGATGCTGG + Intronic
1077649015 11:3952763-3952785 CAGCATGTGAACACTGATCTGGG + Intronic
1080898943 11:36469352-36469374 CAGTAACTCAACACTGCTGCTGG - Intergenic
1084717358 11:70882504-70882526 CAGTATCTGGTCACTGCTGCAGG + Intronic
1090727821 11:129543501-129543523 CAGAAGTTGAACCCTGATGCAGG - Intergenic
1091096007 11:132822620-132822642 CAGTACTGGAACACTGATGGTGG + Intronic
1093038863 12:14356913-14356935 GAGTATGTGCACACTGATCCAGG - Intergenic
1093241557 12:16682961-16682983 GAGTAGATAAACACAGATGCAGG - Intergenic
1094038022 12:26091271-26091293 CAGCGCATGAACACTCATGCTGG + Intergenic
1099171485 12:79370108-79370130 GAGTATAGGAACTCTGTTGCCGG - Intronic
1099660462 12:85552012-85552034 CAGTAAATATACAGTGATGCAGG + Intergenic
1103177312 12:118875777-118875799 CAGTGTATGAAGACTGAGTCTGG + Intergenic
1105299357 13:19118529-19118551 CAGTATATGAATGCTGCTGAAGG + Intergenic
1107588324 13:41876439-41876461 CAGTATAAAAACGCTGAGGCAGG - Intronic
1108157336 13:47599345-47599367 CTGTATATGAAACATGATGCTGG - Intergenic
1113246686 13:108404203-108404225 CAGAAGGTGAACACTGTTGCTGG + Intergenic
1115587436 14:34828614-34828636 CAGAATATGAACAATTATGAAGG - Intronic
1119045692 14:71316672-71316694 GAGTATATGCAGACAGATGCAGG + Intergenic
1120864083 14:89280684-89280706 CAGAATATGAACAGTGACGGCGG + Intronic
1124114220 15:26826051-26826073 AAGTATATGAGCAGTTATGCTGG + Intronic
1125809728 15:42527780-42527802 CAGAATAAGAAGGCTGATGCTGG - Intronic
1127816145 15:62610851-62610873 CTGTATGTGCACACTGCTGCAGG + Intronic
1130427058 15:83811976-83811998 CAGATTATCAACACTGAAGCTGG - Intronic
1133985761 16:10666815-10666837 CCTTATTTGAATACTGATGCGGG + Intronic
1135479136 16:22806795-22806817 AAGTATATGAACACAGATGCAGG + Intergenic
1138695564 16:58809771-58809793 CAGTATATTAGCACTGATAATGG - Intergenic
1143767452 17:9146917-9146939 CAGCATCTCAACACCGATGCCGG - Intronic
1148427214 17:47609295-47609317 GAGTACATGGACACAGATGCAGG + Intronic
1150097423 17:62389664-62389686 GAGTATATGGATACAGATGCTGG - Intronic
1151061587 17:71100863-71100885 CTGTACATGAAGCCTGATGCAGG + Intergenic
1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG + Intergenic
1160199819 18:76787331-76787353 CAGTGAGTGAACACTGATGCAGG - Intergenic
1161902598 19:7130676-7130698 CAGTACAGGAACCATGATGCTGG - Intronic
926678947 2:15649625-15649647 CAGTTTCTGAACCCTGGTGCTGG - Intergenic
929508380 2:42546755-42546777 GATTATATGAACACGGATGCTGG - Intronic
929834917 2:45386659-45386681 AAGTATATGAGCACAGATGTAGG - Intergenic
931068781 2:58620451-58620473 CATTATATGAAATCTGATTCAGG - Intergenic
932255795 2:70285102-70285124 AAGTATAAGAGCAGTGATGCTGG + Intronic
933591449 2:84237609-84237631 TAGTATAAGCACACAGATGCTGG - Intergenic
933635123 2:84700334-84700356 GAATATATGAGCACAGATGCAGG + Intronic
937138842 2:119580365-119580387 GAGTATATAAAGTCTGATGCAGG + Intronic
937811122 2:126200584-126200606 CAGAATAGGAAGACTGATGCAGG - Intergenic
938024154 2:127930924-127930946 CAGTATCTGAGCTCTGATACTGG - Intergenic
939375523 2:141360639-141360661 CAGTATATCAAAGCTGAGGCTGG + Intronic
939717991 2:145609548-145609570 TAGTAAATGAAAACTGATACAGG - Intergenic
941488776 2:166117276-166117298 CTGTATATCAACAATAATGCTGG - Intronic
941831481 2:169965554-169965576 AAGTATAAGAGCAGTGATGCTGG - Intronic
943078082 2:183222541-183222563 CAGGAGATGAATAATGATGCTGG - Intergenic
1170187570 20:13608222-13608244 CTGTAAATGAAAACTGATGTTGG - Intronic
1171284532 20:23926173-23926195 CAGTATATGAACAGTGCTCGTGG + Intergenic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1172442916 20:34978354-34978376 CAGTTTATGAAGACTCAGGCTGG + Intronic
1173438349 20:43053293-43053315 CCAGATATGAGCACTGATGCTGG - Intronic
1177490806 21:21823700-21823722 TAGTATATGAATACTAAGGCAGG + Intergenic
1179776738 21:43669127-43669149 CAGTAAATGATCACCGTTGCAGG + Intronic
1179776747 21:43669184-43669206 CAGTAAATGATCACCGTTGCAGG + Intronic
1180523630 22:16233586-16233608 GAGTATGAGAACACTGCTGCTGG - Intergenic
1182142967 22:27978525-27978547 CAGCATATGATCACTGCAGCCGG - Exonic
1182255210 22:29032946-29032968 CAGTAAATGAACCCTGTGGCAGG + Intronic
1182874602 22:33680156-33680178 GAGTCTGTGAACACTGATGAAGG + Intronic
951077281 3:18410705-18410727 CAGTATATGAACACTGATGCTGG + Intronic
951152516 3:19308561-19308583 TAGTATTTGAACACTTCTGCTGG - Intronic
954661629 3:52229770-52229792 GAGTAGATGAACACTGTTGGGGG + Exonic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
956892560 3:73626347-73626369 CAGTTTCTGAACAGTGAAGCGGG + Intergenic
959220828 3:103517062-103517084 AAGTATATGCACAGTGATGTTGG + Intergenic
959330163 3:104995623-104995645 CATAATATGAGCCCTGATGCTGG - Intergenic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
960553092 3:118997993-118998015 CAGTAGTTAAACACTGATGTTGG - Intronic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
974156229 4:58076811-58076833 GAGTAAATGAACACTGAAACTGG + Intergenic
976827297 4:89275011-89275033 CCAAATATGAACACTGAGGCAGG + Intronic
976836606 4:89381466-89381488 AATTTTAAGAACACTGATGCAGG + Intergenic
977851513 4:101835828-101835850 CAGTATGTCTACACTAATGCTGG - Intronic
978532122 4:109726082-109726104 GAGGATATGAGCACTGGTGCTGG - Intronic
979345672 4:119584116-119584138 GAGTATATGGACTCAGATGCTGG + Intronic
980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG + Intergenic
980844522 4:138308040-138308062 TAATATATGAACACTAAAGCTGG - Intergenic
982351864 4:154424636-154424658 AAGTAAATGAACACTGACACTGG + Intronic
985953159 5:3238578-3238600 CGGTATAGGATCATTGATGCTGG + Intergenic
986746835 5:10752582-10752604 GAGGATAAGAACACAGATGCTGG + Intronic
986749397 5:10773026-10773048 CAGTATTTCAAAACTGCTGCAGG - Intergenic
988373696 5:30405850-30405872 CAATATATGAGTACAGATGCTGG + Intergenic
990715539 5:58632527-58632549 CAGTCTATAAACATTGATGATGG + Intronic
990831586 5:59965048-59965070 GAGTATATGGGCACAGATGCAGG - Intronic
991190475 5:63867393-63867415 CAGTAAATGAACATTGAGGTTGG + Intergenic
1005951542 6:30635300-30635322 AAGTAGATGAAAACTGAGGCCGG + Intronic
1009460106 6:63902844-63902866 CAGTATATGAATAAAGATGTAGG + Intronic
1010550227 6:77212712-77212734 CAGTATATGAAAAATCATGGAGG - Intergenic
1013424504 6:109998688-109998710 CAGCATAGGATGACTGATGCTGG - Intergenic
1014195068 6:118545814-118545836 CACTAAATGAACACTGTTGCAGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016603602 6:145891613-145891635 AAGTATGTGAGTACTGATGCAGG + Intronic
1022221091 7:28314623-28314645 AAGTATATGAACTATGATACTGG - Intronic
1023670598 7:42572075-42572097 CATAATATGACCACTGATGCTGG - Intergenic
1024320724 7:48066165-48066187 CAGTATATAAAAACTTATGGAGG + Intergenic
1029271664 7:99380730-99380752 AAGAATGTGACCACTGATGCTGG + Intronic
1029353826 7:100035393-100035415 AAAAATATGAACACTGATGAAGG + Exonic
1030660706 7:112216217-112216239 CTGTCTATGATCACTGCTGCTGG - Intronic
1030669543 7:112320455-112320477 CACTATATTAACAGTGTTGCAGG + Intronic
1031429666 7:121651435-121651457 CAGTACATGAACCATAATGCTGG - Intergenic
1031757622 7:125665692-125665714 CCGTATATGAACGTTGGTGCGGG - Intergenic
1033302349 7:140197702-140197724 AAGTATGTGAACAATGAAGCAGG - Intergenic
1041750852 8:61259707-61259729 CAGAATTTGAAAACTGGTGCTGG + Intronic
1046306667 8:112376677-112376699 TAGTATACCTACACTGATGCTGG - Intronic
1055410631 9:76025570-76025592 TAGTATAGGAATACAGATGCGGG - Intronic
1058630509 9:106981841-106981863 CATTATATGAAAAATGATACCGG + Intronic
1058814381 9:108669858-108669880 CAAGGTATCAACACTGATGCAGG + Intergenic
1060016063 9:120087517-120087539 CAATAGTTGAACACTGTTGCTGG + Intergenic
1185726209 X:2423942-2423964 CAGAATCTGAACAATGTTGCGGG - Intronic
1186868775 X:13748451-13748473 AAGTACATAAAGACTGATGCAGG - Intronic
1186918644 X:14251610-14251632 CAGTTAATGAACATTGTTGCAGG - Intergenic
1187861529 X:23688243-23688265 CAGTATTTGATTACTGAAGCGGG + Intergenic
1188279728 X:28250551-28250573 CACTATATGATAAGTGATGCGGG - Intergenic
1189944069 X:46159083-46159105 CAGAATATGGACACAGATCCTGG + Intergenic
1194388417 X:93286682-93286704 CTGTATAGGAACCATGATGCTGG + Intergenic
1195324990 X:103751230-103751252 CAGAATATGAACACAAAGGCAGG + Intergenic
1195484364 X:105386791-105386813 CATTATATGAACACATAGGCAGG - Intronic
1200403374 Y:2782874-2782896 CAGTTTATGTACACTGTTGGTGG - Intergenic
1200407311 Y:2826053-2826075 CAGTATATAAACTCTAATTCTGG - Intergenic