ID: 951077583

View in Genome Browser
Species Human (GRCh38)
Location 3:18415022-18415044
Sequence GCTCCCTGGTTTAAAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951077583_951077585 -2 Left 951077583 3:18415022-18415044 CCAGTTGCTTTAAACCAGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 89
Right 951077585 3:18415043-18415065 GCTCCATCAAACCTCAAATCAGG 0: 1
1: 0
2: 1
3: 10
4: 87
951077583_951077586 -1 Left 951077583 3:18415022-18415044 CCAGTTGCTTTAAACCAGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 89
Right 951077586 3:18415044-18415066 CTCCATCAAACCTCAAATCAGGG 0: 1
1: 0
2: 0
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951077583 Original CRISPR GCTCCCTGGTTTAAAGCAAC TGG (reversed) Intronic
901248083 1:7749400-7749422 GCTCCCTGCTATAGAGCTACAGG - Intronic
909427175 1:75538974-75538996 GCACCATGGTTTTAAGCATCAGG + Intronic
910402895 1:86854948-86854970 CATCCCTGGTTTAAAACATCAGG - Intergenic
912043341 1:105419532-105419554 TCTCCCTGATTTAGAGCAAGTGG + Intergenic
912076939 1:105886577-105886599 GCTCTCTGGTTAAAACAAACAGG + Intergenic
917255778 1:173114809-173114831 TCTCACTGTTTTAAAGCAAGGGG - Intergenic
919089033 1:192956205-192956227 GCTGGGTGGTTTAAAACAACAGG - Intergenic
921402107 1:214736257-214736279 GCACCATGGATTAAAACAACTGG + Intergenic
921735311 1:218621187-218621209 GCTCCCAGGTGGAAAGCAAAAGG - Intergenic
1063031406 10:2238884-2238906 GAATCCTGGTTTAAAGCATCGGG + Intergenic
1063562858 10:7146300-7146322 GCTCTCTGGTTTAAAGAACTAGG - Intergenic
1073474067 10:103741519-103741541 GATCCCTGATTTATAGCAACAGG + Intronic
1074443197 10:113496760-113496782 GCCCCCTGGTCTAAAGGAACAGG + Intergenic
1074668463 10:115758742-115758764 GCTCCCTGGGACAAAGCACCTGG - Intronic
1075097454 10:119481866-119481888 GCTCCCTTCTTGAAAGTAACTGG - Intergenic
1079551237 11:21701004-21701026 GCTGCCTTCTTTAAAGAAACAGG + Intergenic
1085364865 11:75930885-75930907 GATCTCTGGTATAAAGCAAATGG + Intronic
1091827420 12:3523346-3523368 GCTTCCTGGTTTAGAGTAGCTGG - Intronic
1093293369 12:17357313-17357335 GATTCTTGGTTAAAAGCAACAGG + Intergenic
1104424834 12:128667568-128667590 GCGCCCTTGTTTAATGCAAAAGG + Intronic
1106376077 13:29189687-29189709 GCTTCCTAGTTTAATTCAACGGG - Intronic
1111091174 13:83450140-83450162 GCTGCCTGGGTTAAAACAGCAGG + Intergenic
1112668505 13:101606811-101606833 TCTCACTTGTTTAAAACAACAGG - Intronic
1119158680 14:72434627-72434649 TCTCCCTGGTTTCAAGCCCCTGG + Intronic
1119599724 14:75967417-75967439 TCTCCCTGGGTTAAGGCAGCTGG + Intronic
1121547446 14:94772226-94772248 TTTCCCAGGTTTAAAGCTACAGG + Intergenic
1121867725 14:97378420-97378442 GGTCCCTGCTTTCAAGCAGCTGG + Intergenic
1126960928 15:53993283-53993305 GGTCCCTGTATTAAAGCAAGGGG + Intergenic
1128705499 15:69834975-69834997 GCTGCCTGGTTGAAGGCAGCAGG + Intergenic
1129896586 15:79112834-79112856 GCTCCCTGTTTTCTAGCAACTGG + Intergenic
1131351604 15:91705859-91705881 GCTCCTTGGTTAAATGCTACAGG - Intergenic
1131530550 15:93187694-93187716 GCTCCCTGGCCTGAAGCAGCAGG + Intergenic
1132076471 15:98825370-98825392 GATCCCTGGTTTAAAGTATACGG - Intronic
1133518358 16:6531867-6531889 GCTCATTGGTTGCAAGCAACAGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1143287313 17:5799954-5799976 GATCCCTAGTCTAAAGCAAAGGG - Intronic
1149554342 17:57562433-57562455 GATCCCTGGTTTCAGGCCACAGG - Intronic
1151875185 17:76864023-76864045 CCTGCGTGGTTTAAGGCAACTGG - Intergenic
1152118228 17:78401893-78401915 GATCCCTGGTCTAATGTAACGGG + Intronic
1155154382 18:23145967-23145989 TGTCCCTGGTTTAAAGCACAGGG + Intronic
1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG + Intronic
1157823369 18:50790181-50790203 GCTCCGTGGTATAAGGCAGCAGG + Intergenic
1160671253 19:364780-364802 GCTCCCTGCTATAAAGGAAGGGG - Intronic
928588150 2:32784075-32784097 CCTTTTTGGTTTAAAGCAACAGG + Intronic
930223310 2:48767466-48767488 GCTCCCTGGGACAGAGCAACTGG - Intronic
933266368 2:80185010-80185032 ACTCAATGGTTTAAAACAACAGG + Intronic
933675201 2:85049631-85049653 GCTACCTTGTTAAAAGAAACTGG - Exonic
939116865 2:138070954-138070976 TCTCCCTGGGATAGAGCAACAGG - Intergenic
940565119 2:155351156-155351178 GCTCCCTGGGTCAGAGCACCTGG - Intergenic
947551111 2:231047505-231047527 TGCCCCTGGTTTAAAGCCACTGG - Exonic
1169308073 20:4510866-4510888 GCTCCCTTGTTTGAATGAACTGG - Intergenic
1169335238 20:4750553-4750575 ACTCCATGGTTAAAAACAACAGG + Intergenic
1169688528 20:8304457-8304479 GCTCAATGGATTTAAGCAACAGG - Intronic
1170523092 20:17208804-17208826 TCTCCCTGGTTGAAAGAATCAGG - Intergenic
1173072516 20:39782721-39782743 GACCCCTGGTTTAAAGTATCAGG + Intergenic
1178780955 21:35603175-35603197 GCTCCCAGGCTTTAAGCAAGAGG + Intronic
1182404882 22:30118242-30118264 GCTCACTGGTTTCCAGCCACTGG + Intronic
1182984358 22:34702377-34702399 GCTCCCAGGTTCCAACCAACTGG + Intergenic
1184040375 22:41939564-41939586 GCTCCCTGGTCTTGAGCATCTGG - Intronic
951077583 3:18415022-18415044 GCTCCCTGGTTTAAAGCAACTGG - Intronic
951594383 3:24301233-24301255 GCTTGGTGGTTTAAAACAACAGG - Intronic
954851110 3:53601397-53601419 GCTCCCTGGTTAAGAACAGCTGG + Intronic
955160890 3:56464494-56464516 ACTCCCTGACTTACAGCAACAGG - Intronic
966297304 3:178439236-178439258 TCTGCCTGGTTTTAAGTAACTGG + Intronic
974153893 4:58045166-58045188 GCTCCCTATTTCAAAGCAACTGG + Intergenic
974482070 4:62457735-62457757 GATCCCTGCTTTAAAGCCATTGG + Intergenic
977467713 4:97402966-97402988 CCTCCCTGGGATAGAGCAACTGG - Intronic
979446943 4:120825021-120825043 GCTTCCTGGTATCAAGGAACAGG - Intronic
979692348 4:123573458-123573480 TCTCCCAGGTTTAAAGCCACTGG + Intergenic
981517255 4:145623222-145623244 TATCCCTGGTTAAAAGCACCAGG + Intronic
986306857 5:6522636-6522658 GCTTTCTGGTTGAAAGCCACCGG - Intergenic
989535063 5:42553611-42553633 TCTCCCTGTTTTAAAGCCAGTGG + Intronic
993994750 5:94709456-94709478 TCTCCCAGGTTTACAGAAACTGG - Intronic
995273295 5:110248098-110248120 GATCCCTAGTTTAAAGCCATAGG + Intergenic
998110390 5:139497340-139497362 TATCCCTAGTTTAAAGCACCGGG - Intergenic
1000359470 5:160433814-160433836 GCTGCATGTTTTCAAGCAACAGG + Intergenic
1005463034 6:26087297-26087319 ACTTCCTGGTGAAAAGCAACAGG - Exonic
1009194615 6:60669043-60669065 GCTTGGTGGATTAAAGCAACAGG + Intergenic
1013420281 6:109960894-109960916 GTTCCCTGCTTTCAAGGAACTGG - Intergenic
1027757168 7:82228776-82228798 GATCACTGGTTTAGAGCAAAGGG - Intronic
1032884532 7:136123636-136123658 GCTCACTGGGATAAAGCAAGAGG + Intergenic
1033277553 7:139984090-139984112 CCTCCCTGGCTTAAAGCTGCTGG + Intronic
1034688400 7:152994493-152994515 GCTTCCTGGTTAGAAGGAACAGG + Intergenic
1047624737 8:126645051-126645073 GTTCCCTGGGTTCAAGGAACAGG + Intergenic
1050724469 9:8631787-8631809 CCTCCCTTGTTTTTAGCAACTGG + Intronic
1051402139 9:16694562-16694584 GCTCCCCTGTTTAGAGCAGCCGG - Intronic
1056603405 9:88064668-88064690 ACTCCCTGTTTGAAAGCAAACGG - Intergenic
1056839403 9:89986424-89986446 TCTCCGTGGTTTAAACCACCAGG - Intergenic
1059434397 9:114267441-114267463 GCCCCCTGGTTGTAAGCAAGGGG - Intronic
1061999982 9:134211125-134211147 GCTCCCAGGTCCACAGCAACTGG + Intergenic
1187919751 X:24189701-24189723 GCTCCCTGGTTTAAAAAAACTGG - Intronic
1189116680 X:38350149-38350171 GCTCCCTTGCTTCAAGCCACAGG - Intronic
1190943930 X:55072683-55072705 TCTCCCTGGGATAGAGCAACTGG - Intergenic
1192922702 X:75724210-75724232 TCTCCCTGGTATAAAGCACTTGG - Intergenic
1198655784 X:138911943-138911965 GCTTCCTGGTTTGAAGTAAAAGG + Intronic
1201465252 Y:14273566-14273588 GATCCCTGGTTTAGAGCAGTTGG + Intergenic