ID: 951077820

View in Genome Browser
Species Human (GRCh38)
Location 3:18418191-18418213
Sequence CCTCTATAAGCTCTGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951077816_951077820 10 Left 951077816 3:18418158-18418180 CCAGGATCCACAATTAGTCCTAC 0: 1
1: 0
2: 0
3: 4
4: 54
Right 951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG 0: 1
1: 0
2: 2
3: 14
4: 202
951077818_951077820 -8 Left 951077818 3:18418176-18418198 CCTACAATACTAATGCCTCTATA 0: 1
1: 0
2: 0
3: 0
4: 117
Right 951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG 0: 1
1: 0
2: 2
3: 14
4: 202
951077817_951077820 3 Left 951077817 3:18418165-18418187 CCACAATTAGTCCTACAATACTA 0: 1
1: 0
2: 0
3: 2
4: 96
Right 951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG 0: 1
1: 0
2: 2
3: 14
4: 202
951077815_951077820 11 Left 951077815 3:18418157-18418179 CCCAGGATCCACAATTAGTCCTA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG 0: 1
1: 0
2: 2
3: 14
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951077820 Original CRISPR CCTCTATAAGCTCTGTCCTC TGG Intronic
906149857 1:43581400-43581422 CGTTTCTAAGCTCTGTCCCCAGG + Intronic
908050267 1:60221905-60221927 CCACTACAACCTCTGTCTTCCGG - Intergenic
909047400 1:70727500-70727522 CCTCTGAAAGCTCTGTCCCGGGG + Intergenic
909913518 1:81289987-81290009 ATTCAATAATCTCTGTCCTCGGG + Intergenic
910821821 1:91358881-91358903 CCTCTAGAAGCTCCATCCCCAGG - Intronic
911563805 1:99438771-99438793 TGTCTCTTAGCTCTGTCCTCCGG + Intergenic
914453853 1:147817135-147817157 CCTCCATGAGCTCTCTGCTCAGG - Intergenic
918131344 1:181632283-181632305 CCTCTATAAACTGGCTCCTCTGG - Intronic
919380632 1:196856304-196856326 CCCCTAGAATGTCTGTCCTCTGG + Intronic
919768556 1:201142720-201142742 CCACTCTGAGCTCTGTCCCCAGG - Intronic
920001793 1:202805965-202805987 CCTCTTTAACCCCTTTCCTCAGG + Intronic
920207013 1:204299576-204299598 CCTCAATAATGGCTGTCCTCTGG - Intronic
922573665 1:226648024-226648046 CCTCTGGAAGCACTGTCATCTGG - Intronic
924296064 1:242587479-242587501 CCTCTATGTGCTCTGTCCCAGGG - Intergenic
1066166682 10:32796070-32796092 CCTCTGTCTCCTCTGTCCTCAGG + Intronic
1069822367 10:71235680-71235702 ATTCTCTAAGCTCAGTCCTCAGG - Intronic
1071836602 10:89424535-89424557 CCTCTAGAATCTCTCTCCTCTGG - Intergenic
1076869862 10:133187958-133187980 CCTCCATGAGCTCTGTCCAGGGG + Intronic
1077813620 11:5663983-5664005 CGTCTAGAACCTCTGACCTCAGG - Exonic
1083147197 11:60768325-60768347 CCTCCAGGAGCTCTGTCCCCTGG + Intronic
1083291073 11:61690549-61690571 CCCCTCTAGGCTCTGTGCTCAGG + Intronic
1083615502 11:64024053-64024075 CCTCTCCAAGCCCTGTCCCCAGG + Intronic
1083966585 11:66047410-66047432 CCAGTAGAAGCTCTGCCCTCGGG - Intronic
1087066984 11:94036513-94036535 ACTCTAGAAGCTCTGTTCTATGG - Intronic
1087772508 11:102225977-102225999 GCCCTGTAAACTCTGTCCTCAGG + Intronic
1089473684 11:118741338-118741360 CCTCTAGGAGCTCAGACCTCTGG + Intergenic
1089650094 11:119907383-119907405 CTCCTAAAAGCTCTGGCCTCTGG - Intergenic
1090330218 11:125925535-125925557 TCTCTATCTACTCTGTCCTCAGG - Intergenic
1092668650 12:10836717-10836739 CCTCTGAAATCTCTGTCCTGAGG - Intronic
1094088558 12:26622251-26622273 CCTGTAAAACCTCTGCCCTCTGG + Exonic
1097910534 12:64965218-64965240 CCTCTGGAAGCTCTGTCCCAGGG + Intergenic
1099369551 12:81812429-81812451 CCTCTATAAGCTCTGTCCCAGGG - Intergenic
1099667847 12:85654099-85654121 CCTCTGGAAGCTCTGTCCCAGGG + Intergenic
1101311986 12:103589326-103589348 CCTCTTTCTGCTCTGTCCTATGG + Intronic
1102448715 12:113024392-113024414 CCTCTATGAGCTCTGCTCTGGGG - Intergenic
1106631738 13:31481267-31481289 GCTCTTTAAGCTCTATCCTATGG - Intergenic
1111919511 13:94395898-94395920 CCTCTACAAGCTATATCATCTGG + Intronic
1112076231 13:95916172-95916194 CTTCTGGAAGCTCTGTCCTAGGG - Intronic
1112899118 13:104337864-104337886 CCACTTTAAGCTTTGTTCTCTGG + Intergenic
1117014418 14:51504299-51504321 CCTCTGGAAGCTCTGTACTGGGG + Intronic
1118431383 14:65722131-65722153 GCTCTAGAACCTCTGTCCTTTGG - Intronic
1120716166 14:87843010-87843032 CCTCTCCATGCTCTGTACTCGGG - Intronic
1121167664 14:91822787-91822809 TCACTGTAAGCTCTGTCTTCTGG + Intronic
1202867442 14_GL000225v1_random:131270-131292 CTTCTATATGCTCTGCCTTCAGG + Intergenic
1202868712 14_GL000225v1_random:139586-139608 CTTTTATAAGCTCTGTCTACAGG + Intergenic
1123810765 15:23923308-23923330 CCTCTATCAGCTCTGTGATTTGG + Intergenic
1124960806 15:34392635-34392657 CCTCTACTGTCTCTGTCCTCAGG - Intronic
1124977435 15:34538856-34538878 CCTCTACTGTCTCTGTCCTCAGG - Intronic
1125054497 15:35341736-35341758 CCTCTGAAAGCTCTGTCCCAGGG + Intronic
1128450550 15:67803707-67803729 CCTCTATCAGCACTGTCCCCTGG - Intronic
1128788047 15:70412731-70412753 CCTCTGTAGGCTCTGTAGTCAGG + Intergenic
1129936198 15:79451933-79451955 TGTCTCTTAGCTCTGTCCTCAGG - Intronic
1131123318 15:89836982-89837004 CGTCTGTAACCTCTGTGCTCTGG + Intronic
1131367435 15:91853026-91853048 CCTCAAGCAGCTCTGACCTCTGG + Intergenic
1132086869 15:98915754-98915776 CCTTTATAATCTATTTCCTCCGG - Intronic
1132348041 15:101120542-101120564 CCTCTGTGAGCTCTGACCTGAGG + Intergenic
1133927194 16:10202822-10202844 CCCCCATGAGCTCTGCCCTCTGG + Intergenic
1136041226 16:27580449-27580471 CCTCTATAAGCCCAGGCCACAGG + Intronic
1136048880 16:27636755-27636777 CCTCTGTGAGCTGTGTGCTCTGG + Intronic
1139753822 16:69126890-69126912 CCTCCATCAGGTGTGTCCTCAGG - Intronic
1142187267 16:88700617-88700639 CCTCTAGCTGCTCAGTCCTCCGG + Intronic
1148023728 17:44570683-44570705 CCTCTATATCCTATGTCATCGGG - Intergenic
1153311386 18:3680288-3680310 CAGCTATGAACTCTGTCCTCAGG + Intronic
1156240125 18:35245543-35245565 CATCTATAAGGTCTCTCTTCTGG - Exonic
1156653748 18:39258407-39258429 CCTCTGGAAGTTCTGTCCTAGGG - Intergenic
1159407854 18:68028368-68028390 CCAGAATAAGCTCTGTCCTGAGG - Intergenic
1160393831 18:78557864-78557886 ACTTTTTAAACTCTGTCCTCAGG - Intergenic
1161115946 19:2496467-2496489 TCTCTGCAACCTCTGTCCTCTGG + Intergenic
1162237330 19:9319583-9319605 CCTAGAGAAGCTTTGTCCTCTGG + Intergenic
1164088069 19:21922076-21922098 CCTGCATAAGCTCTGTCCATAGG + Intergenic
1164108838 19:22135725-22135747 CCTGCATAAGCTCTGTTCACAGG + Intergenic
925646720 2:6044090-6044112 CCTCTAGGAGCTCTGTCCCGGGG - Intergenic
925890862 2:8433531-8433553 CCTCTGTAAGTACTGCCCTCTGG + Intergenic
925890868 2:8433562-8433584 CCTCTGTAAGTACTGCCCTCTGG + Intergenic
925890879 2:8433626-8433648 CCTCTGTAAGTACTGCCCTCTGG + Intergenic
926705398 2:15834076-15834098 CCTCTCTAAGTTCTGTCCTGTGG - Intergenic
928614112 2:33019408-33019430 TCACTGTAACCTCTGTCCTCTGG + Intronic
930955779 2:57201011-57201033 CCTCTATAGGCACTGTCCAGAGG + Intergenic
931614465 2:64142450-64142472 CTTCTACTAGCTCTTTCCTCAGG - Intronic
932752581 2:74380649-74380671 CCTCTCTAAACTCTGGACTCAGG + Intronic
933409470 2:81907167-81907189 CCCCTATAATCCCTGTCTTCTGG - Intergenic
933967245 2:87440098-87440120 CCTCTCTACTCACTGTCCTCTGG + Intergenic
934554680 2:95281115-95281137 CCTCTAAAGGCTCTGTGCTGGGG + Intronic
935147152 2:100403646-100403668 CTCCTTTCAGCTCTGTCCTCTGG - Intronic
935601608 2:104927846-104927868 ACTATATAAGCTCTGGCCTAGGG - Intergenic
935929886 2:108113072-108113094 CCTCTGGAAGCTCTGTCCCAGGG + Intergenic
936326550 2:111510397-111510419 CCTCTCTACTCACTGTCCTCTGG - Intergenic
936577031 2:113665815-113665837 CCCGCATAAGCTCTGTGCTCTGG - Intergenic
936810582 2:116395776-116395798 TCACTCTATGCTCTGTCCTCGGG + Intergenic
936830991 2:116646682-116646704 ACTCTATAATCTCTGAGCTCAGG + Intergenic
942706967 2:178785073-178785095 CCCTTATAATCTCTGTCATCAGG - Intronic
946541535 2:220689566-220689588 CCACTATCTGCCCTGTCCTCAGG + Intergenic
948925191 2:241091759-241091781 CCTCTGTGACCTCTCTCCTCAGG + Exonic
1168831118 20:845715-845737 CCTCTGTAAGATCCGTCCTGTGG - Exonic
1169199973 20:3704165-3704187 CCTTTAAAAGCTCAGTCCTAAGG + Intronic
1172914254 20:38431981-38432003 GTTCTATGAGGTCTGTCCTCTGG - Intergenic
1174911435 20:54612222-54612244 CAAGTATAAGCTCTGTCCTGCGG - Intronic
1177739879 21:25141104-25141126 CCTCTATGAGCCCAGTTCTCTGG + Intergenic
1178041171 21:28642490-28642512 CCTCTTTCAGCTCTGCTCTCTGG + Intergenic
1179212950 21:39341118-39341140 CCTCAACAAGGTCTGTTCTCCGG + Intergenic
1179286132 21:39978804-39978826 CCTCTGTACCCTCTCTCCTCAGG - Intergenic
1182439525 22:30354668-30354690 CATCTCTAACCTCTTTCCTCAGG + Intronic
1185036241 22:48478641-48478663 CCACCTTAGGCTCTGTCCTCAGG + Intergenic
1185051133 22:48554928-48554950 CCTCTTCAAGCTGTGTCCTCGGG + Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
951077820 3:18418191-18418213 CCTCTATAAGCTCTGTCCTCTGG + Intronic
951281569 3:20756468-20756490 CATCTATGAGCTCTGACCTTGGG - Intergenic
951878837 3:27460394-27460416 GCCTTCTAAGCTCTGTCCTCTGG + Intronic
952733212 3:36661811-36661833 CTTCTATAAGCCCTGCCCTTTGG + Intergenic
953053010 3:39362621-39362643 CCTCTGGAAGCTCTGTCCCCGGG - Intergenic
954609357 3:51936166-51936188 CCTCTGGAGTCTCTGTCCTCAGG - Intronic
955681308 3:61505064-61505086 CCTCTGTGAGCTCTGTCCCAGGG + Intergenic
958448929 3:94249373-94249395 CTTCTAAAAGTTCTGTCCTCTGG - Intergenic
959898098 3:111627773-111627795 CCTCTGAAAGCTCTGTCCCAGGG - Intronic
960180995 3:114577720-114577742 CCTATATAAGCTGTTTCCCCAGG - Intronic
961671781 3:128537472-128537494 CCCCAATAAGCTGTTTCCTCTGG - Intergenic
963056970 3:141193872-141193894 CCTCTGAAAGCTCTGTCCCAGGG - Intergenic
964032783 3:152157189-152157211 GCATTATAAGCTCTGTCATCTGG - Intergenic
964183418 3:153914057-153914079 CCTCTGGAAGCTCTGTCCCAGGG + Intergenic
964793111 3:160471318-160471340 CCTATATATCCTCTGTCATCAGG - Intronic
967214277 3:187197412-187197434 CCTCCCCAAGCTCTGTCTTCTGG + Intergenic
967946092 3:194805417-194805439 CCTCTAGAAGCTCTTCTCTCAGG + Intergenic
968437090 4:599279-599301 CCTCTGGAAGCTCTGTCCTCGGG + Intergenic
968451795 4:679395-679417 CCTCTGTCAGCTCTGTGGTCTGG - Intronic
969978271 4:11127135-11127157 CCTCTATAACCTCTGCCTCCCGG - Intergenic
970302644 4:14697653-14697675 CCCCTATAATCTCTGCCCTCTGG + Intergenic
975476183 4:74825939-74825961 CCTCTTTAGCCTCTGCCCTCCGG + Intergenic
978118567 4:105050628-105050650 CCTCTGGGAGCTCTGTCCTAGGG - Intergenic
978452975 4:108856979-108857001 CCTCTATTAGCTCAGTCATTTGG - Intronic
979179579 4:117708145-117708167 CCTCTGGAAGCTCTGTCCCAGGG - Intergenic
980475666 4:133311346-133311368 TCACTATAAGCTCTGTCTCCTGG + Intergenic
980751191 4:137091641-137091663 TCTTTATAAACTCTCTCCTCCGG - Intergenic
981609330 4:146576572-146576594 ACTTTATGAGCTCTGTCCACTGG + Intergenic
981750927 4:148091789-148091811 CCTCTATCAGCTCTGTACTGGGG - Intronic
982420874 4:155195858-155195880 CTTCTAACAGCTCTGTCCTCTGG - Intergenic
983628416 4:169826196-169826218 CCTCTAGGAGCTCTGTCCCAGGG + Intergenic
988664054 5:33305477-33305499 CCTCTATTATCTATCTCCTCTGG + Intergenic
988725462 5:33922059-33922081 CCTCTATACTCTCTCTCCTTGGG + Intergenic
988935911 5:36082938-36082960 CCTCTGGGAGCTCTGTCCTAGGG - Intergenic
993494063 5:88587294-88587316 CCTCTGGAAGCTCTGTCCCAGGG - Intergenic
993792182 5:92222293-92222315 CCTCTGGGAGCTCTGTCCTAGGG + Intergenic
995079245 5:108028581-108028603 CCTCTTTAACCCCTGTGCTCTGG + Intronic
995578963 5:113574331-113574353 CCTCTGGAAGTTCTGTCCTGGGG + Intronic
996910839 5:128655583-128655605 CCCCTATATGCTCTGTCCCAGGG + Intronic
999028137 5:148259202-148259224 CCTCTGAAAGCTCTGTCCCAGGG + Intergenic
1000343734 5:160297024-160297046 CCTCCATTAGCTAAGTCCTCAGG - Intronic
1001663514 5:173413809-173413831 TCTCTGTTGGCTCTGTCCTCAGG + Intergenic
1003902486 6:10668080-10668102 CCTATAGAAGCTTTGTCCTGGGG + Intergenic
1006583315 6:35089013-35089035 CCTGCATAGCCTCTGTCCTCAGG + Exonic
1006854204 6:37121577-37121599 GCTCTATAAGCACTGTCACCTGG - Intergenic
1007767997 6:44172371-44172393 TTTCTTGAAGCTCTGTCCTCTGG - Exonic
1008082723 6:47210505-47210527 CCTCTGTAAGCTTTGTCCCGGGG - Intergenic
1008173085 6:48233851-48233873 CCTCTAGGAGCTCTATCCTAGGG - Intergenic
1008588551 6:52970607-52970629 CTTCTTTAAGATCTGTCCTGTGG + Intergenic
1009417886 6:63435957-63435979 CATCACTAATCTCTGTCCTCTGG + Intergenic
1012869493 6:104656821-104656843 CCTCTGGAAGCTCTGTCCCAGGG - Intergenic
1012878100 6:104753513-104753535 CCTCTGGAAGCTCTGTCCCAGGG - Intronic
1013156423 6:107495158-107495180 CCTCTCTAAGCAGTGGCCTCAGG + Intronic
1013171832 6:107643489-107643511 CCACTATAACCTCTGCCTTCTGG + Intronic
1014131986 6:117845767-117845789 CCTCTATAAGCTTTGAGCTCTGG + Intergenic
1014163976 6:118202812-118202834 CTCCTTTAAGCTCTGTCATCAGG + Intronic
1014818720 6:125961727-125961749 GCTCTCTAAACTCTGTTCTCTGG + Intronic
1015498060 6:133901626-133901648 CATCTATAATCTCTGTACTCTGG + Intergenic
1016423710 6:143912622-143912644 CCTCTAGAAGCTCTATCCTGGGG + Intronic
1016854129 6:148649587-148649609 CCTCTCTAAGCTCTGACTTATGG + Intergenic
1017344925 6:153369638-153369660 CCTCTGGAAGCTCTGTCCCAGGG - Intergenic
1018940909 6:168308455-168308477 CCTCAAACAGCTGTGTCCTCAGG - Exonic
1019212243 6:170416131-170416153 CCTCTGTGAGCTCTCTCCTTTGG + Intergenic
1021949407 7:25760257-25760279 CCTCTCTCAGCTCTGTCCCCAGG - Intergenic
1022453001 7:30533413-30533435 CCTCTACTGTCTCTGTCCTCAGG - Intronic
1024489776 7:49967153-49967175 CCTGGAGAAGCTCTGCCCTCTGG - Intronic
1025745824 7:64241782-64241804 CCTGCATGAGCCCTGTCCTCAGG - Intronic
1026116066 7:67496761-67496783 CCTCTGTAAGCCTTCTCCTCTGG - Intergenic
1026796900 7:73371799-73371821 TCACTGAAAGCTCTGTCCTCTGG - Intergenic
1028082876 7:86599811-86599833 CCTCTGGAAGCTCTGTCCCAGGG - Intergenic
1029484307 7:100829726-100829748 CCTCTAAAAGTTATGTCTTCTGG + Intronic
1031330795 7:120461158-120461180 CCTCTTTAAGCTGGGTGCTCGGG - Intronic
1032668703 7:134064110-134064132 CAACCATAAGCTCTGTCCTTTGG - Intronic
1034312104 7:150097853-150097875 CCCTCATATGCTCTGTCCTCTGG + Intergenic
1034794751 7:154002805-154002827 CCCTCATATGCTCTGTCCTCTGG - Intronic
1035132420 7:156668446-156668468 CCTCAACAGCCTCTGTCCTCTGG - Intronic
1036234036 8:7022747-7022769 CCTCTCAGCGCTCTGTCCTCCGG - Intergenic
1037831751 8:22194001-22194023 CCTCTATAGGGGGTGTCCTCAGG + Intronic
1043363115 8:79499205-79499227 CCTCTGGAAGCTCTGTCCCAAGG + Intergenic
1043795442 8:84531999-84532021 CCTCTCTTAGTTTTGTCCTCAGG + Intronic
1043973731 8:86562330-86562352 CCACTATCAGCTCTGCCATCTGG - Intronic
1045984843 8:108237806-108237828 CGTATATAATCACTGTCCTCTGG + Intronic
1046756502 8:117978084-117978106 CTTCTATCTGCTCTGTCCCCAGG + Intronic
1046911384 8:119631289-119631311 TCACTACAAGCTCTGTCTTCTGG + Intronic
1046984448 8:120371490-120371512 CCTCTTTGAGCTCTCTTCTCTGG - Exonic
1050901996 9:10961038-10961060 TCTCTATAAGCTCTGCCTCCCGG - Intergenic
1053062979 9:35045725-35045747 CCACTGTAAGCACTGTCCTTGGG + Exonic
1053356008 9:37446030-37446052 TCTCTATAACCTCTGCCCCCTGG - Intronic
1053931849 9:43119277-43119299 CCTCTTTAATCTCTTTACTCTGG + Intergenic
1055343241 9:75308326-75308348 CTTCTGGAAGCTCTGTCCTAGGG + Intergenic
1055826325 9:80329559-80329581 CCTGAATTAGCTCTGTCATCAGG - Intergenic
1056001017 9:82216444-82216466 CCTCCAGAAGCTCTGTCCCAGGG - Intergenic
1056042034 9:82678088-82678110 TCTCTCTAAGCTCTGACTTCAGG + Intergenic
1056269517 9:84933308-84933330 CCTCCATGACCTCTGTCCTTTGG + Intronic
1058691057 9:107521286-107521308 CCTCTAGAAGATCTGTCCCTGGG + Intergenic
1059509916 9:114835799-114835821 CCTCTGGAAGCTCTGTCCCAGGG + Intergenic
1059548575 9:115204015-115204037 CATCTAAAAGCTGTGTCCTTAGG - Intronic
1060424119 9:123490512-123490534 TCACTATAACCTCTGTCCCCTGG - Intronic
1062709290 9:137965065-137965087 CCTCTATAAGCTTTGTCCCAGGG + Intronic
1203736064 Un_GL000216v2:140667-140689 CTTTTATAAGCTCTGTCTACAGG - Intergenic
1187423164 X:19154230-19154252 CCTGCATAAGCTCTCTTCTCTGG + Intergenic
1187549179 X:20284111-20284133 CCTTTCCAAACTCTGTCCTCTGG + Intergenic
1187917392 X:24167502-24167524 CCTATATAAACTGTCTCCTCTGG - Intronic
1191209564 X:57871168-57871190 CCTCTGAAAGCTCTGTCCCAGGG + Intergenic
1191693063 X:63960575-63960597 CTTCCATAATTTCTGTCCTCTGG + Intergenic
1191699137 X:64020696-64020718 ACTTGATAAGCTCTGTCCACAGG - Intergenic
1191930227 X:66364598-66364620 CCTCTGGAAGCTATGTCCTAGGG + Intergenic
1192277401 X:69648065-69648087 CCTCTGGAAGCTCTGTCCCAGGG + Intronic
1196528817 X:116759379-116759401 CCTCTGGAAGCTCTGTCCCAGGG - Intergenic
1197122155 X:122905955-122905977 CCTCTGGGAGCTCTGTCCTAAGG - Intergenic
1197279717 X:124520879-124520901 CCTGTTTAAGCTCTCTCCTTTGG - Intronic
1199601712 X:149545060-149545082 CCAATCTCAGCTCTGTCCTCAGG - Intronic
1199648663 X:149934423-149934445 CCAATCTCAGCTCTGTCCTCAGG + Intronic
1199915246 X:152332695-152332717 CCTGTAAAAGCCCTGTTCTCTGG + Intronic