ID: 951078450

View in Genome Browser
Species Human (GRCh38)
Location 3:18424831-18424853
Sequence CTGGCTTTCGGCTGGGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951078444_951078450 -9 Left 951078444 3:18424817-18424839 CCTCTAGAGTCGCCCTGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 951078450 3:18424831-18424853 CTGGCTTTCGGCTGGGCCCCCGG 0: 1
1: 0
2: 3
3: 32
4: 242
951078441_951078450 20 Left 951078441 3:18424788-18424810 CCGAAATGAAAGAGGGGGGCGGG 0: 1
1: 0
2: 1
3: 15
4: 111
Right 951078450 3:18424831-18424853 CTGGCTTTCGGCTGGGCCCCCGG 0: 1
1: 0
2: 3
3: 32
4: 242
951078439_951078450 21 Left 951078439 3:18424787-18424809 CCCGAAATGAAAGAGGGGGGCGG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 951078450 3:18424831-18424853 CTGGCTTTCGGCTGGGCCCCCGG 0: 1
1: 0
2: 3
3: 32
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951078450 Original CRISPR CTGGCTTTCGGCTGGGCCCC CGG Intronic
900576448 1:3384929-3384951 CTGCCTTTCTGCTGGGCTCCTGG + Intronic
900623544 1:3598136-3598158 CAGGCTGTTGGCTGGGCCCCTGG - Intronic
901492298 1:9602719-9602741 GTGGCTACAGGCTGGGCCCCTGG + Intronic
901608142 1:10475215-10475237 CTGGTGTTTGGCTGTGCCCCCGG + Intronic
902230226 1:15022984-15023006 CTGGCATTCGGCACAGCCCCTGG - Intronic
902671411 1:17976968-17976990 CTGGATTTCAGCTGGGCACATGG + Intergenic
903027103 1:20437173-20437195 CTGACTTCCTGCAGGGCCCCAGG - Intergenic
903070753 1:20726001-20726023 CTGGCAGTCGGCAGGGCACCAGG + Exonic
903811015 1:26035176-26035198 GCGGCTTTGGCCTGGGCCCCGGG - Exonic
904266621 1:29321982-29322004 CCAGCTTTCTGCTGGGCCCAGGG + Intronic
904277667 1:29394870-29394892 CTGCCTTTTCGCTGGGGCCCTGG - Intergenic
904682990 1:32241607-32241629 CTGGCCTTCTGCTGGGCCCCGGG - Intergenic
904688866 1:32279028-32279050 CTTACTCTCGGCTGGGCACCAGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905403840 1:37720381-37720403 CTGGCTTCGGGCGGGGCCCCCGG - Exonic
906001073 1:42425704-42425726 ATGGCTTTCTGCTGTGCCACAGG - Intergenic
907047069 1:51305857-51305879 CTGGCTGTGTGCTGGGCACCAGG - Intronic
907319432 1:53593557-53593579 CAGGGTTTGGGCTGGGGCCCAGG - Intronic
907373088 1:54015603-54015625 CTGGCTCTGGGCTGGGCCCTGGG - Intronic
909890057 1:80994227-80994249 CTGGCTTTTGGCTGGGGCAGTGG + Intergenic
916653277 1:166850151-166850173 CTGGCTTCTGGCTGGGAACCTGG + Exonic
918310088 1:183279555-183279577 CTGTCTCTCGCCTGGGCCTCAGG - Intronic
919326647 1:196115834-196115856 CAGGCTATCAGCTGGGCCCACGG + Intergenic
920174220 1:204090030-204090052 CTGCCTTATGGCTGGGCCTCTGG + Intronic
920206270 1:204294505-204294527 CTGGCTTTGGGCTGTGTCCTGGG - Intronic
921265616 1:213418482-213418504 CTGACTCTGGGATGGGCCCCTGG + Intergenic
1067210564 10:44257574-44257596 GTGGCAATCGGCTGGGCCCATGG - Intergenic
1070606528 10:77902185-77902207 CTGGGTGTGGGCTGGACCCCAGG - Intronic
1074116463 10:110460491-110460513 CTGGATCTCTGCTGGGCCCAGGG + Intergenic
1074857088 10:117481489-117481511 TTGGCTTTGGGATGGGCCCTGGG - Intergenic
1075106251 10:119542142-119542164 CGGGCATCCGACTGGGCCCCTGG - Intronic
1075647311 10:124104949-124104971 CTGGCCTCTGGTTGGGCCCCGGG + Intergenic
1075737150 10:124670922-124670944 CTGGCATTCAGCTAGGCCCTGGG - Intronic
1076763816 10:132619655-132619677 CAGGCTTTTGCCTGGGCACCTGG + Intronic
1077104706 11:837140-837162 GTGGCTCTGAGCTGGGCCCCGGG + Intronic
1077316318 11:1920916-1920938 CTGGTTTTCTGCTGAGCGCCTGG - Intronic
1078565927 11:12414010-12414032 CCTGCCTTTGGCTGGGCCCCTGG + Intronic
1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG + Exonic
1083182283 11:60994847-60994869 CTGACTTTCCTCTGGGCGCCAGG + Intronic
1083221305 11:61254563-61254585 CTGCCTTTCTGCTTGTCCCCAGG - Intergenic
1083721545 11:64606110-64606132 CTGGCTTTTGGCTGGGGTCTGGG - Intergenic
1084664956 11:70571371-70571393 CAGGCTCTCGGCTAGGCCACTGG + Intronic
1084954748 11:72685302-72685324 CTCCCTTCCGGCAGGGCCCCAGG + Exonic
1085020094 11:73201321-73201343 CTGTGTTTCTTCTGGGCCCCTGG + Intergenic
1089413540 11:118267293-118267315 CTGGCTTTCGTTTGGGCTCCTGG + Intergenic
1090720183 11:129465445-129465467 ATGGCTTTTGGCTGGGGCCAAGG + Intergenic
1092155797 12:6280821-6280843 CTGGCCTCCTGCTCGGCCCCTGG + Intergenic
1092630224 12:10368649-10368671 CCGGCTGTAGTCTGGGCCCCAGG - Intergenic
1093371909 12:18376004-18376026 CAGGCTTATGGCTGGGCACCCGG - Intronic
1096977053 12:55705490-55705512 CTGGACTTGGGCTGGGGCCCTGG - Intronic
1098185541 12:67892410-67892432 CCGTCTGTCAGCTGGGCCCCGGG + Intergenic
1102887843 12:116534912-116534934 CTGGCTCTCGCCTGGGGCCTTGG - Intergenic
1103205238 12:119123806-119123828 CTGGCCTTGCGCTGGGCCCAAGG + Intronic
1104405195 12:128511088-128511110 CTGGCATTTGGGTGGGCCCAGGG + Intronic
1104713754 12:131003640-131003662 CTTGCTCTCAGCTGGGCTCCAGG + Intronic
1106563399 13:30865476-30865498 GTGGCTTTGGGCTGGGCTGCTGG - Intergenic
1107972277 13:45654964-45654986 CAGGCTTCTGCCTGGGCCCCAGG + Intergenic
1112368504 13:98774948-98774970 CAGGCATGGGGCTGGGCCCCAGG + Intergenic
1112771570 13:102799579-102799601 CTGGCCCTCCGCTGGGCACCTGG + Intronic
1113517764 13:110915711-110915733 GTGGGTCTCGGCTGCGCCCCGGG + Intergenic
1114792219 14:25672373-25672395 CTGGCTTGCCCCTGAGCCCCGGG + Intergenic
1116932720 14:50705626-50705648 CTGGGCTTCGGCTGCGCACCTGG - Intergenic
1119767148 14:77197375-77197397 CTGGCGTAGGGCTGGGGCCCTGG - Intronic
1119806906 14:77488023-77488045 TTGGCTATGGGCTGGGCCTCTGG - Intronic
1120821475 14:88915400-88915422 CTGGGTTTCAACAGGGCCCCAGG - Intergenic
1120953513 14:90062215-90062237 CGGGGTTTCAGCTGGGGCCCGGG + Exonic
1121020271 14:90575623-90575645 CTGGCTGTGGGCTGGGCTCCTGG + Intronic
1121466191 14:94116846-94116868 CAGGCACTGGGCTGGGCCCCAGG + Intergenic
1122248569 14:100422228-100422250 CTGGCTGTCTGCTGGGACCCTGG + Intronic
1122255545 14:100473149-100473171 CTTGCTGTGGGCTGGGCCCTGGG + Intronic
1122350128 14:101084209-101084231 CTGGCTCTAGGCTGGGCCCTAGG + Intergenic
1122872252 14:104644389-104644411 TCTGCTTTCGGCTGGGCCTCGGG - Intergenic
1122884385 14:104704085-104704107 CTGGCTTCTGGCTGGACCCCTGG - Intronic
1123935325 15:25191275-25191297 CTGGCTCTGGGCTCAGCCCCTGG + Intergenic
1124370634 15:29103111-29103133 CTGGCTTGGGGATGGGCCACAGG + Intronic
1126102855 15:45130028-45130050 CTGGCTGCCAGCTGGGCCCGCGG - Exonic
1128496113 15:68199577-68199599 CTGGCGTCGGGCTGGCCCCCAGG + Exonic
1129242865 15:74261860-74261882 AGGGCCTTGGGCTGGGCCCCTGG - Intronic
1129450886 15:75650610-75650632 CTGGCTCTCTGCTGGGCCCTGGG + Intronic
1130885749 15:88091045-88091067 CTGACTTTCCTCTGGGGCCCAGG - Intronic
1131356726 15:91751736-91751758 CTGGCTTCAGGCTGGGTGCCTGG + Intergenic
1132376978 15:101334851-101334873 CTGCCTGTCTGCTGGGTCCCTGG - Intronic
1132517778 16:373891-373913 CTGGCGTTGGGCACGGCCCCTGG - Intronic
1133269339 16:4602811-4602833 CTGGCCTTGGCCTGGGTCCCAGG + Intergenic
1134372111 16:13635464-13635486 CTGACTTTCACCTGGGACCCAGG - Intergenic
1136016192 16:27402631-27402653 CTGGTTTTCTGCTGGGACCAGGG + Intronic
1136690665 16:32025888-32025910 CTGGCTTTTGGCCGGGTCCTGGG - Intergenic
1136735909 16:32467531-32467553 CTGGCTTTCGGCTGGTACTAGGG + Intergenic
1136791250 16:32969449-32969471 CTGGCTTTTGGCCGGGTCCTGGG - Intergenic
1136878564 16:33884483-33884505 CTGGCTTTTGGCCGGGTCCTGGG + Intergenic
1138125375 16:54434073-54434095 CAGGCATTCAGCTGGTCCCCAGG - Intergenic
1138669125 16:58598689-58598711 CTGGCTTTGGGCTGGTGCTCAGG - Intronic
1139583471 16:67886399-67886421 CTTGCTTGCGGCTGGGGCCAGGG + Intronic
1141412189 16:83843224-83843246 CTGGCATTGTTCTGGGCCCCGGG + Intergenic
1141619173 16:85227748-85227770 CTGGCTCTGCGCTGGGCCCTGGG + Intergenic
1142373951 16:89697329-89697351 CTGGCCTAGGGCCGGGCCCCGGG + Exonic
1203017166 16_KI270728v1_random:362043-362065 CTGGCTTTCGGCTGGTACTAGGG - Intergenic
1203035501 16_KI270728v1_random:635201-635223 CTGGCTTTCGGCTGGTACTAGGG - Intergenic
1203093459 16_KI270728v1_random:1230911-1230933 CTGGCTTTTGGCCGGGTCCTGGG - Intergenic
1142633753 17:1243577-1243599 TTGGCTTACGGCAGTGCCCCTGG - Intergenic
1143135651 17:4710923-4710945 CTCGCTTTCTGCAGGGGCCCGGG - Intronic
1143670385 17:8392459-8392481 CTGGCTTTGGGCAGGTCACCTGG + Exonic
1144863320 17:18319256-18319278 ATGGCTCTCAGGTGGGCCCCGGG - Intronic
1146245414 17:31277611-31277633 CTGGCTTTCAGCTGGCCCATAGG + Intronic
1147153529 17:38532031-38532053 CTGGCTTTTGGCCGGGTCCTGGG - Exonic
1147418755 17:40311659-40311681 CTGTCTCTGGGCTGGGCGCCAGG + Intronic
1147632529 17:41941319-41941341 CTGGCTTTCTCCAGGCCCCCAGG + Intronic
1149647279 17:58249642-58249664 CTGCCCTTCGGCTGGACGCCGGG + Exonic
1149746750 17:59106467-59106489 CCGGCTCTCGGCGGGGCCGCTGG + Exonic
1149849353 17:60026144-60026166 TTGGCGTTCGGCTGGTCCTCTGG - Intergenic
1149860815 17:60120380-60120402 TTGGCGTTCGGCTGGTCCTCTGG + Intergenic
1150657578 17:67050282-67050304 CTGGCTTTGGCCTAGGCCTCTGG - Intronic
1151727396 17:75892834-75892856 CTGGCTCTCAGCTGGGCCTGTGG + Exonic
1152206447 17:78977021-78977043 CTGGCTAACCGCTGGGCCCCGGG + Intronic
1152473432 17:80503063-80503085 CTGGCTTAGAGCTGGGCCCCTGG + Intergenic
1152537930 17:80961160-80961182 CTGGCTCAGGGCTGGGCCCTAGG - Intronic
1152929476 17:83102466-83102488 CTTGCTTTGGGCTGAGCCCCTGG - Intergenic
1153915336 18:9739849-9739871 CTGAGTTTTAGCTGGGCCCCTGG - Intronic
1156888302 18:42160964-42160986 CTAGCATGGGGCTGGGCCCCAGG - Intergenic
1157569955 18:48705684-48705706 CGGGAGTTGGGCTGGGCCCCTGG - Intronic
1158601866 18:58863277-58863299 CTGGCTCGCGGCTTCGCCCCGGG - Intronic
1159682693 18:71374195-71374217 GTGGCCTTCGGGTGGCCCCCAGG + Intergenic
1160734724 19:657316-657338 CTGGCTTTCTGTCGGGCTCCCGG + Intronic
1160747351 19:718463-718485 CTGGCTTTCAGCAGGGTCTCAGG - Intronic
1160862733 19:1244568-1244590 CAGGCTTCTGCCTGGGCCCCAGG + Exonic
1160932697 19:1578140-1578162 CGGGCTCTCGGCAGGGCCTCTGG + Exonic
1161250179 19:3276082-3276104 CTGGCTCTGGGGTGGGACCCTGG + Intronic
1161273229 19:3401669-3401691 CTGGGTTAGGGCTGGGACCCTGG - Intronic
1162021304 19:7869714-7869736 CTGGCTTTCCGCGGAGCCCCAGG - Exonic
1162033773 19:7928253-7928275 CTGGCTGGCGGCAGGGCACCTGG - Intronic
1162869304 19:13573475-13573497 CTGGCTGTGGGCTGGGCTCTGGG - Intronic
1163033347 19:14558485-14558507 GTTGCTGTTGGCTGGGCCCCGGG + Intronic
1163126313 19:15246120-15246142 CAGGTTTTAGGCGGGGCCCCAGG - Intronic
1163635419 19:18435038-18435060 CTCGCTTGAGGCTGGGCCCTGGG + Exonic
1163699416 19:18779871-18779893 CTGGCTCCTGGCTGGGCCCCGGG - Exonic
1164175276 19:22768241-22768263 CTGGCTTTCTCCTGGACCTCTGG + Intronic
1165094474 19:33402788-33402810 CTGCCTCTCTGCTGGCCCCCAGG - Intronic
1165156296 19:33790705-33790727 ATTGCTTTGGGCTGTGCCCCTGG - Intergenic
1166267145 19:41691326-41691348 ATGCCTTTCGGCTGAGCCCCAGG + Intronic
1166315700 19:41988288-41988310 CAGGCTGTGGGCTGGGACCCTGG - Intronic
1166855679 19:45781735-45781757 CTGCCTGTCGGCTGCGCCCCTGG + Intronic
1167561325 19:50227601-50227623 CTGGCTAGCGTCTGGGCACCTGG - Intronic
926313321 2:11691214-11691236 CTGGCTCTGGACTGTGCCCCCGG - Intronic
927698507 2:25252677-25252699 CTTGCTTTCGCCCGGACCCCCGG - Intronic
928929705 2:36611558-36611580 CTGTCTTTCCACTTGGCCCCAGG - Intronic
932776048 2:74529070-74529092 GGGGCCTTCAGCTGGGCCCCAGG + Intronic
934712895 2:96527400-96527422 GGGGCTTTCGGCGGGGCCCGAGG + Intergenic
936092122 2:109508175-109508197 CAGGGTTTTGGCTGGGCCCATGG - Intergenic
936092857 2:109512172-109512194 CTGGCTCTGGCCTGGGACCCTGG + Intergenic
937230412 2:120395278-120395300 CTGGCTTGAGGCGGGGGCCCTGG + Intergenic
937880439 2:126860345-126860367 CTGGATTTCAGCTAGACCCCAGG + Intergenic
938314160 2:130314917-130314939 GTGGCTTTTGGGTGGGCCTCAGG + Intergenic
940276738 2:151947764-151947786 CTCTCTTTCTGCTGGGCTCCGGG - Intronic
941450372 2:165653430-165653452 AAGGCCTTCAGCTGGGCCCCTGG - Intronic
944106343 2:196083513-196083535 ATGGTTTTGGGCTGGGCCCAGGG + Intergenic
944389403 2:199201685-199201707 CTTTCTTTGGTCTGGGCCCCAGG - Intergenic
947634966 2:231675329-231675351 CTGGCTTCGAGCTGGGCCTCTGG - Intergenic
948060019 2:235036009-235036031 CTGACTTTAGGCTGGGGCCGAGG - Intronic
948171167 2:235904456-235904478 CTGGCTCTTGAGTGGGCCCCAGG + Intronic
948918254 2:241049165-241049187 CTGGCTTCTGTCCGGGCCCCCGG - Intronic
1170736967 20:19021129-19021151 GTGGCTTATGTCTGGGCCCCAGG - Intergenic
1171823211 20:29874263-29874285 CTGGGCTTCGGCTGGGGCGCGGG - Intergenic
1171896884 20:30816049-30816071 CTGGGCTTCGGCTGGGGCGCGGG + Intergenic
1173310677 20:41893700-41893722 CTGGCTTCTTGGTGGGCCCCTGG + Intergenic
1173580795 20:44145166-44145188 CTGGCTCTGAGCTGAGCCCCAGG - Intronic
1173839218 20:46146271-46146293 CAGGCTTAGTGCTGGGCCCCTGG + Intergenic
1174648386 20:52104767-52104789 CTGGGCTTCGGCTGCGCGCCTGG - Intronic
1175979014 20:62727790-62727812 CTGGCCCTCGGCTGTGGCCCTGG - Intronic
1176022940 20:62971317-62971339 CTGGCTTTCGGCTGCCCGCAGGG - Intergenic
1176065347 20:63191376-63191398 CTGGCTTCCTGCTGTGGCCCAGG - Intergenic
1176121679 20:63456906-63456928 CTGGCTTTCTGCTCATCCCCGGG - Intronic
1176555727 21:8253305-8253327 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1176574664 21:8436339-8436361 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1176611277 21:8987631-8987653 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1176707201 21:10125496-10125518 CTGCCCTTGTGCTGGGCCCCGGG + Intergenic
1179167284 21:38944854-38944876 CAGGCTTTGGTCTGGGCACCAGG - Intergenic
1179525632 21:41974237-41974259 CTGGCTTTCTTCTGTGCCACAGG - Intergenic
1179600704 21:42475792-42475814 CCTGCCTTCAGCTGGGCCCCAGG - Intronic
1180226770 21:46398108-46398130 CTGGCTGTCGCGAGGGCCCCAGG - Exonic
1181167965 22:20993395-20993417 CTTGCCTTCGGCTGGGCCCCAGG - Intronic
1181259569 22:21587715-21587737 GTGGCCTTCTGCTGGGGCCCAGG + Intronic
1181527121 22:23496341-23496363 CAGGCTTTGTGCTGGGCCCAGGG + Intergenic
1181527190 22:23496679-23496701 CTGCCTCTCTGCTGGGCCCAGGG - Intergenic
1182146663 22:28000957-28000979 CTGACTGCTGGCTGGGCCCCAGG - Intronic
1182684464 22:32110828-32110850 CTAGCTTGAGGCTGGGGCCCGGG - Exonic
1183727420 22:39597465-39597487 CTGGCCTTGGGCAGGGCCTCTGG - Intronic
1184342982 22:43896256-43896278 CTGGCTTCTGGCTGGGGCCCAGG + Intergenic
1184656954 22:45946698-45946720 CTGGCTTTGCCCTGGGCCCCTGG - Intronic
1185197314 22:49480063-49480085 CTGGATTTCAGGTTGGCCCCTGG - Intronic
1203252711 22_KI270733v1_random:125389-125411 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1203260768 22_KI270733v1_random:170476-170498 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
950887209 3:16372801-16372823 CTGGCTTCAGTCTGGCCCCCTGG - Intronic
951078450 3:18424831-18424853 CTGGCTTTCGGCTGGGCCCCCGG + Intronic
954688386 3:52382896-52382918 GGGGCTTCAGGCTGGGCCCCTGG - Intronic
956689801 3:71865007-71865029 CAGGCTCTGGGCTGGGCCCCAGG + Intergenic
957275837 3:78090458-78090480 CTGGCTTTCAGCTAGGCATCAGG + Intergenic
959582210 3:107993356-107993378 CTGACTTTTGTCTGGGTCCCAGG - Intergenic
964534047 3:157699953-157699975 CTGGCTGTGGGGTGGGCCCCAGG - Intergenic
966945360 3:184773802-184773824 CTGGCTTTCGGCCGTGACACTGG - Intergenic
968619640 4:1598089-1598111 GTGGCCTTCGGCTGGGCCTGGGG - Intergenic
968930820 4:3577687-3577709 CTGGGCTTGGGCTGGGCCCCTGG + Intronic
970405760 4:15761769-15761791 CTGGCTGTGGGCTGGGTTCCAGG - Intergenic
971260687 4:25054165-25054187 CAGGCTTTATTCTGGGCCCCAGG + Intergenic
972275336 4:37552085-37552107 CTGGTTTTGGGCCTGGCCCCGGG - Intronic
973373985 4:49275654-49275676 CAGGCCTTGCGCTGGGCCCCAGG + Intergenic
973383427 4:49334585-49334607 CAGGCCTTGCGCTGGGCCCCAGG - Intergenic
973386384 4:49516910-49516932 CAGGCCTTGGGCTGGGCCTCAGG - Intergenic
976207943 4:82639943-82639965 CTTGCTCTCTGCTGGGCCCTGGG + Intronic
978618694 4:110619488-110619510 CGGGGTTGCGGCTGGGCCACCGG - Intronic
978708179 4:111742074-111742096 CTGGCTATCAGCTGGCCCCCAGG - Intergenic
985444653 4:190015335-190015357 CTGGGCTTCGGCTGGGGCGCAGG - Intergenic
985539941 5:483175-483197 CAGGCTTTCTACTGGGCCCAGGG - Intronic
985768657 5:1795572-1795594 CTGGCATCTGGCAGGGCCCCAGG + Intergenic
986287616 5:6371427-6371449 CAGGCTTTAGGATGGGCCCTGGG - Intergenic
987051369 5:14149147-14149169 CTGGCTTCCTGCTGGACCCCTGG + Intronic
987100688 5:14588932-14588954 CTGACTTTGGGCTGGGCACATGG - Intronic
991508339 5:67349784-67349806 ATTGCTTTGGGCTGGGACCCAGG + Intergenic
992363720 5:76070109-76070131 CTGGGTGTGGGCTGGGGCCCTGG - Intergenic
994204245 5:97015768-97015790 CTGCCTTTTGCCTGGGTCCCTGG - Intronic
997591044 5:135072544-135072566 CTGGCTTTTGGCTTGGAGCCCGG + Intronic
998213995 5:140223695-140223717 CCAGCTTTCAGCTGGGTCCCTGG + Intronic
998880708 5:146642095-146642117 CTGGCTCTCTGCTGGGACTCTGG + Intronic
999140561 5:149358441-149358463 CTGGCTGTTGGCTAGGCGCCCGG + Intronic
1000012759 5:157248047-157248069 CTGGGTTTGGGCTAGGGCCCAGG + Intronic
1001286511 5:170427664-170427686 CCGGCCTGCTGCTGGGCCCCAGG + Intronic
1003476892 6:6491736-6491758 CTGCCCTTCTCCTGGGCCCCAGG + Intergenic
1004480779 6:16017541-16017563 CTGGCTTTGGTCCGGGCCCCGGG - Intergenic
1005928891 6:30466253-30466275 CGGGCTTCCGGCTTGGCCGCGGG + Intergenic
1006060940 6:31418422-31418444 CTGCATTTTGGCTGGACCCCAGG - Intergenic
1007400455 6:41599756-41599778 CTGGCCTTCCCCTGGGCTCCCGG - Exonic
1014015477 6:116525291-116525313 CTGGCCTCTGTCTGGGCCCCTGG + Intronic
1017717510 6:157222906-157222928 CTGGGGTGGGGCTGGGCCCCTGG + Intergenic
1019455814 7:1126938-1126960 CAGGCCTTCGGTTGGGCCCTGGG - Intronic
1019461225 7:1159964-1159986 CTGGCTCTCGTCGGGGACCCAGG + Exonic
1019612801 7:1945513-1945535 CTGGGTTGCGGCTGTGACCCAGG - Intronic
1025073073 7:55918257-55918279 CTGGCTTTCAGCTGGGAGCTCGG - Intronic
1029126334 7:98297347-98297369 CTGGCTTTCAGAGGGGTCCCGGG + Intronic
1029493119 7:100882992-100883014 CTGGCTCCTGGCTGGGCGCCCGG - Intronic
1029496109 7:100896041-100896063 CTGGAGTGCGTCTGGGCCCCGGG - Intronic
1031672659 7:124569095-124569117 CTGACTTTCCTCTGTGCCCCTGG - Intergenic
1036999420 8:13700008-13700030 ATGACTTTCGGCATGGCCCCAGG + Intergenic
1037804490 8:22051449-22051471 AAGGCTTTCGGCTTGGTCCCTGG - Intronic
1038828387 8:31032609-31032631 CTGGATTTCGGCTGCGCCCCCGG + Exonic
1040871739 8:52106787-52106809 CTGGCTGTTGCCTGGGCCACGGG - Intergenic
1045056304 8:98371167-98371189 GTGGCTTTAGGCTGGGCCCTGGG - Intergenic
1045428341 8:102089064-102089086 CTGGCTTCAGGGTGGACCCCAGG - Intronic
1048976289 8:139674769-139674791 CTGTCTTGCTGCTAGGCCCCAGG - Intronic
1049100218 8:140573950-140573972 CTGAGGTTTGGCTGGGCCCCTGG - Intronic
1049197593 8:141324229-141324251 CAGGCTCTGGGCTGGGCACCAGG - Intergenic
1049367864 8:142249386-142249408 CTGGGTCAGGGCTGGGCCCCAGG - Intronic
1049537263 8:143188175-143188197 CTGGGCTTCTGCTGGGCACCAGG + Intergenic
1053351566 9:37416838-37416860 CTGGCTGTCAGCTGAGCCCCTGG - Intergenic
1053749511 9:41237333-41237355 CTGGGCTTCGGCTGGGGCACGGG + Intergenic
1054254957 9:62802213-62802235 CTGGGCTTCGGCTGGGGCACGGG + Intergenic
1054459298 9:65454226-65454248 CCGGGCTTGGGCTGGGCCCCTGG - Intergenic
1054798618 9:69325354-69325376 TGGGCTTTCGGGTGGGCCGCAGG + Intronic
1055210067 9:73780861-73780883 TTGGCTTTGGGCTGGGTGCCAGG - Intergenic
1056892098 9:90503824-90503846 CTGCCTTTCTACTGGGCTCCTGG + Intergenic
1060265439 9:122109162-122109184 CTGGCTTTGGCCTGGTCCCCAGG + Intergenic
1060893315 9:127202147-127202169 CTGGCTTTCGTCTTGGCATCTGG - Intronic
1060987307 9:127827099-127827121 CTGACTTTGTGCTGGGCCCTGGG + Intronic
1061245248 9:129398300-129398322 CTGGCTTTCCTCTGGTCTCCAGG - Intergenic
1061897079 9:133653839-133653861 CTGGCTTGTGCCTGGGACCCAGG - Intronic
1062040277 9:134401390-134401412 CCGGCTTTAGGCTGGGCCTGCGG - Intronic
1062328601 9:136025134-136025156 CAGGCTTTCAGCTGAGGCCCTGG + Intronic
1062538895 9:137032820-137032842 CTGACTATAGGCTGGGCCCAGGG + Exonic
1202791949 9_KI270719v1_random:94371-94393 CTGCCCTTGTGCTGGGCCCCGGG + Intergenic
1203469115 Un_GL000220v1:108541-108563 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1203476936 Un_GL000220v1:152513-152535 CCGGGCTTCGGCCGGGCCCCGGG + Intergenic
1185603779 X:1355504-1355526 CTGGGTCTCCCCTGGGCCCCTGG - Intronic
1187162736 X:16779773-16779795 CTGGCATTCTGCTGGGCACTGGG + Intergenic
1189059575 X:37738422-37738444 CTGGCCTGAGGCTGGGCCCAGGG + Intronic
1191875119 X:65788034-65788056 CTGAGTTTCTGCTGGGGCCCTGG + Intergenic
1193148859 X:78104499-78104521 TTAGCTTTTGGCTGGGCCCCAGG + Intronic
1194205106 X:91002816-91002838 CAGGCTTTGGGCTGAGCCCCAGG - Intergenic
1198274888 X:135090842-135090864 CTGCCTTTAGTCTGGGCTCCTGG - Intergenic
1200058546 X:153473961-153473983 CTGGGTTTCGGGTGGGCTCCTGG - Intronic
1200550926 Y:4577937-4577959 CAGGCTTTGGGCTGAGCCCCAGG - Intergenic