ID: 951079629

View in Genome Browser
Species Human (GRCh38)
Location 3:18437727-18437749
Sequence AGTGATCTCCAGACTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951079629_951079633 18 Left 951079629 3:18437727-18437749 CCTCCCACAGTCTGGAGATCACT 0: 1
1: 0
2: 0
3: 20
4: 358
Right 951079633 3:18437768-18437790 CATCTAAGTATCATTTCAGTTGG 0: 1
1: 0
2: 0
3: 18
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951079629 Original CRISPR AGTGATCTCCAGACTGTGGG AGG (reversed) Intronic
900429577 1:2595427-2595449 AGTGAGTGCCACACTGTGGGAGG + Intronic
900689698 1:3973209-3973231 TGTGATCTCAGGACTTTGGGAGG - Intergenic
901073508 1:6536569-6536591 TGTAATCTCAGGACTGTGGGAGG + Intronic
901102942 1:6733417-6733439 TGTAATCTCCACACTTTGGGAGG + Intergenic
901104619 1:6745549-6745571 AGTAATCTCAGCACTGTGGGAGG + Intergenic
901867945 1:12119721-12119743 AGTAATCTCAGCACTGTGGGAGG - Intronic
902220317 1:14960482-14960504 TGAGCTCTGCAGACTGTGGGTGG + Intronic
902670139 1:17967560-17967582 AGTGATATCCAGTGAGTGGGTGG - Intergenic
903859261 1:26355150-26355172 TGAGATCTCCAGCCTTTGGGGGG - Intergenic
904020623 1:27461916-27461938 TGTAATCTCCACACTTTGGGAGG - Intronic
904176610 1:28634157-28634179 TGTAATCTCCACACTTTGGGAGG + Intronic
905943654 1:41884220-41884242 TGTAATCTCAAGACTTTGGGAGG - Intronic
906397786 1:45482268-45482290 TGTGATCTCAGGACTTTGGGAGG + Intronic
907999775 1:59668724-59668746 TGTGATCCCCACACTTTGGGAGG + Intronic
908254828 1:62294629-62294651 AGTGATCCCCAGAACCTGGGTGG + Intronic
908993480 1:70124266-70124288 AGTAATCCCCACACTTTGGGAGG + Intronic
911606608 1:99912964-99912986 TGTAATCTCCACACTTTGGGGGG + Intronic
911829243 1:102529970-102529992 ATTGAGCTCCATAATGTGGGTGG + Intergenic
912842529 1:113051639-113051661 TGTAATCTCAAGACTTTGGGAGG + Intergenic
914949478 1:152099946-152099968 TGTAATCTCCACACTTTGGGAGG - Intergenic
914984049 1:152441435-152441457 AGGGATCTTCATACTTTGGGAGG + Intergenic
915209898 1:154300712-154300734 TGTAATCTCCACACTTTGGGAGG - Intergenic
915315291 1:155025198-155025220 TGTGAGCTCCAGACTGTGTCTGG + Intronic
916308999 1:163373319-163373341 TGTGATCCCCACACTTTGGGAGG - Intergenic
916513862 1:165497505-165497527 AGTGACCTCCAAACTTTGGGAGG + Intergenic
917675843 1:177318668-177318690 AATGATCTCCAGATTGGAGGAGG - Intergenic
918063276 1:181080764-181080786 AGTGATGTGCAGAATTTGGGCGG + Intergenic
918212805 1:182366598-182366620 TGTAATCCCAAGACTGTGGGAGG + Intergenic
918426503 1:184415533-184415555 AGTGCTTTCCAAACTGTGGGAGG + Intronic
918738298 1:188095124-188095146 TGTGATCCCCACACTTTGGGGGG + Intergenic
919971005 1:202578636-202578658 AGTTTTCTCATGACTGTGGGAGG - Intronic
924361265 1:243243780-243243802 TGTGATCTCAATACTTTGGGAGG - Intronic
1063393271 10:5664040-5664062 AGTGATTTCCAGACCATCGGGGG + Intronic
1064186292 10:13164800-13164822 TGTGATCTCAACACTTTGGGAGG + Intronic
1064402156 10:15030495-15030517 TGTAATCTCCACACTTTGGGAGG - Intergenic
1065764006 10:29009509-29009531 AGTAATCTCAACACTTTGGGAGG - Intergenic
1066478063 10:35767128-35767150 TGTAATCTCCACACTTTGGGAGG - Intergenic
1067148037 10:43707795-43707817 AGTGATCACCGCACTGTGTGGGG + Intergenic
1067241477 10:44498437-44498459 ATTGATTTCCATAATGTGGGTGG - Intergenic
1067241645 10:44500268-44500290 AGTGATTGCCAGAAAGTGGGAGG - Intergenic
1068246506 10:54378034-54378056 ACTAATCTGCAGACTGTGGTGGG - Intronic
1068818987 10:61351489-61351511 AGCAATCTCCACACTTTGGGAGG - Intergenic
1071252034 10:83828635-83828657 ATTGCTCTCCATACTGTGGGTGG + Intergenic
1071576188 10:86728447-86728469 AGTGAAGTCCAGCCTGTGAGAGG + Intronic
1072115188 10:92364050-92364072 TGTAATCTCCACACTTTGGGAGG + Intergenic
1073887542 10:108057462-108057484 AATGACCTCCTGTCTGTGGGAGG - Intergenic
1075127213 10:119710168-119710190 TGTAATCTCAACACTGTGGGAGG + Intergenic
1076643753 10:131937126-131937148 AGTGAGCACCAGATTGTGGAAGG + Intronic
1077700026 11:4432521-4432543 AATGATGTCCAGGCTGTGGGTGG + Intergenic
1078170905 11:8928556-8928578 ATTGCACTCCAGCCTGTGGGAGG - Intronic
1078664845 11:13315894-13315916 AGTGAGCTCCAGAAAGGGGGAGG - Intronic
1079310528 11:19361572-19361594 AGTGACCTCAGGACTGTGGATGG - Intronic
1080436119 11:32246277-32246299 TGTAATCTCCACACTCTGGGAGG - Intergenic
1081345917 11:41985987-41986009 TGTAATCTCCACACTTTGGGAGG - Intergenic
1082270937 11:50168929-50168951 TGTGATCTCAACACTGTGGGAGG - Intergenic
1082939985 11:58694465-58694487 ATTGCTCTCCCGAATGTGGGTGG + Intronic
1083603596 11:63963301-63963323 TGTGATCTCAGCACTGTGGGAGG - Intergenic
1084696970 11:70761578-70761600 AGTCTTCTCCAGAATGTGAGGGG - Intronic
1085418678 11:76337192-76337214 AGTGAGCTGCAGAATCTGGGTGG - Intergenic
1085869696 11:80334771-80334793 TGTAATCCTCAGACTGTGGGAGG + Intergenic
1086360611 11:86055072-86055094 TGTAATCTCAACACTGTGGGAGG + Intronic
1087088860 11:94247544-94247566 TGTAATCTCAACACTGTGGGAGG + Intergenic
1087237319 11:95734460-95734482 AGTGGGCTTCAGACTGTGTGTGG - Intergenic
1088419205 11:109623649-109623671 AATGGTCTCCGGAGTGTGGGGGG - Intergenic
1089068670 11:115681695-115681717 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1089463518 11:118667455-118667477 AGTAATCTCAACACTTTGGGAGG - Intronic
1089942855 11:122437738-122437760 AGTAATCTCAACACTTTGGGAGG + Intergenic
1090688251 11:129149160-129149182 ATTGGCCTCCAGCCTGTGGGTGG - Intronic
1091309550 11:134562860-134562882 ACTGAGCCCCAGGCTGTGGGTGG + Intergenic
1091466672 12:690804-690826 TGTGATCTCAACACTTTGGGAGG + Intergenic
1092455921 12:8642586-8642608 TGTGATCTCAACACTTTGGGAGG + Intronic
1092523064 12:9292972-9292994 AGTGTTCTCCAGTCTGTATGTGG + Intergenic
1093904804 12:24677816-24677838 AGTAATCTCAACACTTTGGGAGG - Intergenic
1094543015 12:31378278-31378300 TGTAATCTCAACACTGTGGGAGG - Intergenic
1094708138 12:32934809-32934831 ATTGATCTCCTTACTGTTGGTGG + Intergenic
1095190228 12:39249861-39249883 ATTGTTCTCCATAATGTGGGTGG + Intergenic
1096193305 12:49633729-49633751 CATGATCTCTACACTGTGGGAGG + Intronic
1096277892 12:50226296-50226318 TGTGATCCCCACACTTTGGGAGG - Intronic
1096369690 12:51058676-51058698 AGTGATCCCAAAACTTTGGGAGG - Intronic
1097016647 12:55992114-55992136 AGTGAACCCCAGAATCTGGGAGG + Exonic
1099604529 12:84785729-84785751 TGTGATCACCAGATTGTGAGAGG - Intergenic
1100193641 12:92219665-92219687 AGTAATCTCAACACTTTGGGAGG - Intergenic
1100641518 12:96485984-96486006 TGTGATCTCAATACTTTGGGAGG - Intergenic
1101378420 12:104191001-104191023 ATTGACCTCCAAAATGTGGGTGG - Intergenic
1102728043 12:115082853-115082875 TGTAATCCCCACACTGTGGGAGG - Intergenic
1103100520 12:118170503-118170525 TGTAATCTCCACACTTTGGGAGG + Intronic
1103320515 12:120090301-120090323 AGTGATCTCCAGACTTGGAATGG + Intronic
1103576167 12:121878929-121878951 TGTAATCTCCACACTTTGGGAGG - Intergenic
1103833706 12:123801581-123801603 ACTGATCTCCAGGCTGTCGTTGG + Intronic
1104158268 12:126153959-126153981 AGGGATGCCCAGATTGTGGGTGG + Intergenic
1104316495 12:127707995-127708017 TGTGATCTCAACACTTTGGGAGG - Intergenic
1104521097 12:129476080-129476102 ACTGTCCTCCACACTGTGGGGGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107530301 13:41276734-41276756 AGAGACCTCCAGGCTGGGGGAGG + Intergenic
1110910013 13:80947763-80947785 TGTAATCCCCACACTGTGGGAGG + Intergenic
1113414165 13:110115121-110115143 TGTGATGTCCAGGCTGTGGGAGG + Intergenic
1114450889 14:22824517-22824539 TGTAATCTCCACACTTTGGGAGG - Intronic
1115465492 14:33709921-33709943 AGTGCTCTCCAGGCTGGGCGTGG - Intronic
1116235889 14:42279185-42279207 AGTGAGCTCCAGGCTGGGGACGG - Intergenic
1116666776 14:47786736-47786758 AGTAATCTCAACACTTTGGGAGG - Intergenic
1117349039 14:54862709-54862731 AGTAATCTCAACACTTTGGGAGG - Intronic
1118826842 14:69391387-69391409 TGTGATCCCCAGACTTTGGGAGG + Intronic
1118891265 14:69911223-69911245 AGGGATATCCAGACTGTGCCTGG + Intronic
1119427562 14:74545729-74545751 TGTGTTCTCCAGACTCTGGCAGG + Intronic
1119472599 14:74909185-74909207 TGTGACCTCCAGTGTGTGGGAGG + Exonic
1119637104 14:76282741-76282763 AGTGCTCTCCCTAATGTGGGTGG + Intergenic
1121073955 14:91051320-91051342 TGTAATCTCCACACTTTGGGAGG + Intronic
1121097436 14:91227553-91227575 TGTGATCTCAACACTTTGGGAGG + Intergenic
1121746798 14:96302325-96302347 AGTAATCTCAACACTTTGGGAGG + Intronic
1123765759 15:23477234-23477256 AGTGATCCCAACACTTTGGGAGG - Intergenic
1125119563 15:36138208-36138230 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1125388600 15:39166873-39166895 AGTCACCTCCAGACAGTGGGAGG + Intergenic
1126501228 15:49347760-49347782 AGTAATCTCAACACTTTGGGAGG + Intronic
1126625676 15:50684113-50684135 AGTAATCCCCATACTTTGGGAGG - Intronic
1127076476 15:55331455-55331477 TGTAATCTCCACACTTTGGGAGG + Intronic
1127601668 15:60543736-60543758 AGTGATCCCAGCACTGTGGGAGG - Intronic
1128193355 15:65726212-65726234 TGTAATCTCCACACTTTGGGAGG - Intronic
1128250341 15:66159588-66159610 AGTGACCTACAGCGTGTGGGAGG + Intronic
1129062971 15:72875108-72875130 TGTGATCTCAACACTTTGGGAGG - Intergenic
1129159275 15:73738284-73738306 AGTGATTTCCAGGCTGTGCCTGG - Exonic
1129349283 15:74945353-74945375 ATTGCACTCCAGCCTGTGGGGGG - Intergenic
1131334683 15:91536804-91536826 ATTGATGTCAAGACTGTGGCAGG - Intergenic
1133548947 16:6835155-6835177 TGTGATCCCAACACTGTGGGAGG - Intronic
1134616144 16:15652294-15652316 AGTAATCTCAGCACTGTGGGAGG - Intronic
1135058189 16:19248562-19248584 TGTAATCTCCACACTTTGGGAGG + Intronic
1136077897 16:27829361-27829383 AATGTTCTACAAACTGTGGGAGG + Intronic
1137692200 16:50436516-50436538 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1137806119 16:51307128-51307150 ATTGTTCTCCAGAATGTGGATGG - Intergenic
1139389161 16:66594927-66594949 TGTGATCCCAAGAGTGTGGGGGG + Intergenic
1139599658 16:67979046-67979068 TGTAATCTCCACACTGTGGGAGG + Intronic
1139622145 16:68154174-68154196 AGTAATCTCAACACTTTGGGAGG - Intronic
1140087547 16:71810164-71810186 TGTCATCTCCACACTTTGGGAGG - Intergenic
1140167774 16:72571995-72572017 AGTAATCTCAGGACTTTGGGAGG + Intergenic
1140432620 16:74917550-74917572 AGTGATCCCAGCACTGTGGGAGG + Intronic
1140818208 16:78639820-78639842 TGTGATCCCAACACTGTGGGAGG - Intronic
1140824273 16:78691438-78691460 TGTAATCTCCACACTTTGGGAGG + Intronic
1140875162 16:79144154-79144176 TGTAATCTCCACACTTTGGGAGG - Intronic
1140881159 16:79199317-79199339 TGTGATCTCAACACTTTGGGAGG - Intronic
1141548040 16:84785563-84785585 TGTGATCCCCACACTTTGGGTGG + Intergenic
1141613897 16:85199340-85199362 TGTAATCTCCACACTTTGGGAGG - Intergenic
1142339426 16:89511092-89511114 TGTGATCTCAACACTTTGGGAGG - Intronic
1142358352 16:89614536-89614558 TGTAATCCCCACACTGTGGGAGG + Intronic
1142648930 17:1333791-1333813 AGTGTTCTTCAGACTTTGGTTGG - Intergenic
1142817377 17:2437136-2437158 TGTGATCTCAACACTTTGGGAGG - Intronic
1145949244 17:28803262-28803284 TGTAATCTCCACACTTTGGGAGG - Intronic
1146411598 17:32590364-32590386 AGGGATCTCCTGACTCTGGTAGG + Intronic
1146553466 17:33802529-33802551 AGTCATCTCCAGGCAGTGTGTGG + Intronic
1146890352 17:36502569-36502591 AGTGGTCTCCAGAAAGTGTGAGG + Intronic
1148043161 17:44724721-44724743 TGTGATCTCAACACTTTGGGAGG + Intronic
1148066917 17:44877873-44877895 TGTAATCTCCACACTTTGGGAGG + Intronic
1150377106 17:64690407-64690429 AGTGATCTCAGCACTTTGGGAGG - Intergenic
1150910754 17:69384993-69385015 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1151758389 17:76087547-76087569 AGGTATCTCCAGTCTGTGGAGGG - Intronic
1151784426 17:76268472-76268494 AGTCATCCCCAGAGGGTGGGGGG + Intronic
1152109461 17:78349687-78349709 AGAGGTCTCCAGGGTGTGGGAGG + Intergenic
1152715912 17:81900614-81900636 ACTGATCCCTACACTGTGGGAGG - Intronic
1154996200 18:21642479-21642501 TGTAATCTCCACACTTTGGGAGG + Intergenic
1156706519 18:39889189-39889211 TGTGATCTCAACACTTTGGGAGG - Intergenic
1156999807 18:43510816-43510838 TGTGGTCTCCAGACTGGTGGTGG + Intergenic
1157528917 18:48405943-48405965 AGTGAACCCCAGCCTGTGTGCGG - Intronic
1157621887 18:49021497-49021519 AGAGAGCTCCGGCCTGTGGGAGG + Intergenic
1157992617 18:52515349-52515371 TGTAATCTCAATACTGTGGGAGG + Intronic
1158142317 18:54269037-54269059 TGTGATCTCAACACTTTGGGAGG + Intergenic
1159638620 18:70837014-70837036 TGTAATCTCCACACTTTGGGAGG - Intergenic
1160736832 19:666797-666819 TGTGATCCCCACACTTTGGGAGG - Intergenic
1161738601 19:6006846-6006868 AGTGATCCCCACACTATGGGAGG - Intronic
1162902047 19:13800883-13800905 TGTGATCTCAACACTTTGGGAGG + Intronic
1163731144 19:18949984-18950006 TGTAATCTCCGCACTGTGGGAGG - Intergenic
1163995402 19:21041388-21041410 AGTAATCTCAGGACTTTGGGAGG - Intronic
1165857316 19:38887520-38887542 TGTGATCCCCACACTTTGGGAGG - Intronic
1166233018 19:41436665-41436687 AGTAATCTCCAGACTGGGCAGGG - Intronic
1168006664 19:53495476-53495498 TGTAATCTCCACACTTTGGGAGG - Exonic
1168152096 19:54454783-54454805 TGTGATCGCCAGGCTGGGGGTGG + Intronic
1168384470 19:55951666-55951688 AGTGATTTTAAGTCTGTGGGAGG - Intronic
926579461 2:14618813-14618835 CGTGCTCTGCAGACAGTGGGAGG - Intergenic
927863185 2:26573233-26573255 AGTGAGCTCCAGAAGGAGGGAGG + Intronic
927917375 2:26945775-26945797 AGTAAACTCCAGGCTGTGGGTGG - Intronic
927974772 2:27329883-27329905 TGTAATCTCAACACTGTGGGAGG + Intronic
929500373 2:42486056-42486078 AGGGATCTCCAGCATGTTGGTGG - Intronic
931355295 2:61532579-61532601 TGTCATCTCCACACTTTGGGAGG + Intronic
931562638 2:63579201-63579223 ACTGGCCTCCAGACTGTGTGAGG - Intronic
932054527 2:68431366-68431388 TGTAATCTCAAGACTTTGGGAGG - Intergenic
932263850 2:70349469-70349491 ATTATTCTCCATACTGTGGGTGG + Intergenic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
934847272 2:97669907-97669929 TGTGTTCCCCACACTGTGGGAGG - Intergenic
934856124 2:97731512-97731534 TGTTATCTCCAGACTGTTGTGGG + Intronic
935043670 2:99459447-99459469 TGTAATCTCCACACTTTGGGAGG + Intronic
937522570 2:122730513-122730535 TGTGATCTCAACACTTTGGGAGG + Intergenic
938107704 2:128544638-128544660 AGTCATCTCCAGGAGGTGGGGGG + Intergenic
938244889 2:129768673-129768695 ATTGAGCTCCAGGCTGTGGTGGG - Intergenic
938903343 2:135817125-135817147 AGTAATCTCTTCACTGTGGGAGG - Intronic
940087110 2:149872794-149872816 AGAGAGCTCCAAACTGTGTGAGG - Intergenic
941536905 2:166734870-166734892 AGTTATCTGCAGATTGTGGTAGG - Intergenic
941908933 2:170743760-170743782 AGTAATCTTCAGACATTGGGTGG - Intergenic
942133465 2:172903110-172903132 TGTAATCTCAACACTGTGGGAGG + Intronic
943613726 2:190067339-190067361 AGTGATCCCCAGACTGTACTTGG + Intronic
944577144 2:201100640-201100662 TGTGATCTCAGGACTTTGGGAGG + Intergenic
946901885 2:224380938-224380960 AGTGAACTCCATCCTGTGGAGGG - Intronic
948559118 2:238838881-238838903 TGTGCTCTTCAGACTGTGGTTGG + Intergenic
1169488940 20:6055494-6055516 AAAGATCTTCAGGCTGTGGGTGG - Intergenic
1169955411 20:11097518-11097540 AGTTAACTACAGAGTGTGGGTGG + Intergenic
1170986570 20:21264832-21264854 AGTTATCTCCTGACTGCGGTTGG + Intergenic
1171415556 20:24978052-24978074 ACTGTTCTCCAGGCAGTGGGTGG - Intronic
1172215707 20:33234186-33234208 ACTGCTCTCCAGAGTCTGGGTGG - Intergenic
1172233487 20:33353036-33353058 AGTAATCCCCACACTTTGGGAGG + Intergenic
1173119686 20:40277344-40277366 AGTGATCACCTGATGGTGGGAGG + Intergenic
1174025007 20:47566764-47566786 TGTAATCTCAACACTGTGGGTGG - Intronic
1174642175 20:52054100-52054122 TGTGATCTCAGAACTGTGGGAGG - Intronic
1174708671 20:52682878-52682900 TGTAATCTCCACACTTTGGGAGG + Intergenic
1174747343 20:53076560-53076582 AGTGATCTTCAGACTGGGTCAGG - Intronic
1175126467 20:56755840-56755862 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1176029226 20:63003283-63003305 AGAGATGTGCAGGCTGTGGGAGG - Intergenic
1176383447 21:6125440-6125462 TGTAATCTCCACACTTTGGGGGG - Intergenic
1177155794 21:17500078-17500100 TGTAATCTCAACACTGTGGGAGG + Intergenic
1179123113 21:38567059-38567081 AGGAATCGCCAGACTGGGGGGGG + Intronic
1179187802 21:39097987-39098009 AGTGACCTGCAGGCTGTGGTTGG - Intergenic
1179438120 21:41375853-41375875 AGTGTGATCCAGAGTGTGGGGGG + Intronic
1179479537 21:41668733-41668755 TGTGATCCCCAGACTGCAGGCGG + Intergenic
1179740022 21:43412798-43412820 TGTAATCTCCACACTTTGGGGGG + Intergenic
1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG + Intergenic
1181403758 22:22667504-22667526 TGTGAGCTCCAGAGGGTGGGTGG - Intergenic
1183512419 22:38243902-38243924 AGGGAGCTGCAGACTGTGGTGGG + Intronic
1184165106 22:42722482-42722504 TGTAATCACCACACTGTGGGAGG - Intergenic
1184173990 22:42775773-42775795 AGTAATCTCAATACTTTGGGAGG - Intergenic
1184367810 22:44063663-44063685 AGTGATCCCCAGAGTATGTGTGG + Intronic
1184790717 22:46698107-46698129 AGTGGTCCTCAGACTGTGGTGGG - Intronic
1185093420 22:48790443-48790465 TGTGATCTCAACACTGTGGGAGG - Intronic
949431354 3:3979496-3979518 ATTGTTCTCAAGGCTGTGGGGGG + Intronic
949669027 3:6377041-6377063 TGTAATCTCCGGACTTTGGGAGG + Intergenic
950391177 3:12697952-12697974 TGTAATCTCCACACTTTGGGCGG + Intergenic
950604158 3:14063623-14063645 TGTAATCTCCACACTTTGGGAGG - Intronic
951079629 3:18437727-18437749 AGTGATCTCCAGACTGTGGGAGG - Intronic
951480810 3:23160377-23160399 AGTAATCCCCACACTTTGGGAGG + Intergenic
952243741 3:31562527-31562549 GGTGATCCCCAGTTTGTGGGTGG + Intronic
953096822 3:39785128-39785150 AGTGCTCTCCCTAATGTGGGTGG - Intergenic
955481088 3:59391151-59391173 TGTAATCTCCACACTTTGGGAGG + Intergenic
960608730 3:119534933-119534955 TGTAATCTCCACACTTTGGGAGG + Intronic
961269707 3:125679961-125679983 GGTGAACACCAGACTCTGGGTGG + Intergenic
962548095 3:136457837-136457859 TGTAATCTCCAAACTTTGGGAGG + Intronic
964344528 3:155743273-155743295 TGTGATCCCCACACTTTGGGAGG + Intronic
965752688 3:171992540-171992562 TGTGATCCCAACACTGTGGGAGG - Intergenic
966228666 3:177626405-177626427 ATTGTTCTCCATAATGTGGGTGG - Intergenic
967059287 3:185857801-185857823 AGTAATCTCAACACTTTGGGAGG + Intergenic
968802683 4:2753683-2753705 AGTCATCTCCAGAATGTTGGTGG - Intronic
970094504 4:12447392-12447414 AGTGATCTGCAGACTTTTCGAGG - Intergenic
971504574 4:27352240-27352262 AGGGATTTGTAGACTGTGGGAGG - Intergenic
972538549 4:40019536-40019558 ACTGAACTCCAGACTGGGTGAGG + Intergenic
974005861 4:56556614-56556636 TGTAATCTCAAGACTTTGGGAGG + Intronic
974189616 4:58488215-58488237 TGTAATCTCCACACTTTGGGAGG + Intergenic
975782068 4:77849922-77849944 TGTAATCTCCACACTTTGGGAGG + Intergenic
978892154 4:113842795-113842817 ATTGCTCTCCATAATGTGGGTGG - Intergenic
979862675 4:125713941-125713963 ATTGCTCTCCATAATGTGGGTGG + Intergenic
981095277 4:140772919-140772941 TGTGATCCCAACACTGTGGGAGG - Intergenic
981292041 4:143087568-143087590 AGTAATCTCAACACTTTGGGAGG - Intergenic
982165933 4:152613745-152613767 AATGATCCCCAGCCTGTGGAGGG - Intergenic
983669920 4:170224731-170224753 AGTTAACTCCACAATGTGGGTGG - Intergenic
984154963 4:176185295-176185317 AGTGACCTACAGAGTCTGGGTGG - Intronic
984483777 4:180339201-180339223 AGAGATTTCCAGATTGAGGGAGG + Intergenic
984742815 4:183183523-183183545 TGTAATCTCCACACTTTGGGAGG + Intronic
987211203 5:15685383-15685405 AGTGATCTCAAGATTGTATGAGG + Intronic
987270371 5:16302143-16302165 ATTACTCTCCATACTGTGGGTGG - Intergenic
988570580 5:32361069-32361091 TGTAATCTCAAGACTTTGGGAGG - Intronic
989647109 5:43646553-43646575 AGTAATCTCAGCACTGTGGGAGG - Intronic
990967456 5:61464615-61464637 TGAGAGCTCCAGAGTGTGGGTGG + Intronic
991058912 5:62350653-62350675 TGTAATCTCCACACTTTGGGAGG + Intronic
991718318 5:69472668-69472690 TGTAATCTCCACACTGGGGGAGG - Intergenic
992223679 5:74597656-74597678 TGTGATCTCAACACTTTGGGAGG - Intergenic
993691059 5:91000941-91000963 ATTGCTCTCCCTACTGTGGGTGG - Intronic
995157360 5:108930868-108930890 TGTGATCTCAACACTTTGGGAGG - Intronic
995786715 5:115838830-115838852 AGTAATCTCCACACTTTGGGAGG + Intronic
997128018 5:131247895-131247917 TGTAATCCCCAGACTTTGGGAGG - Intronic
998057153 5:139087927-139087949 AGTGAGCACCTGGCTGTGGGTGG - Intronic
998122915 5:139593870-139593892 TGTAATCTCCACACTTTGGGAGG - Intronic
999437354 5:151573397-151573419 TGTGATCTCAGGACTTTGGGAGG + Intergenic
1000268332 5:159659031-159659053 TGTGATCTCAACACTTTGGGAGG + Intergenic
1000354155 5:160377343-160377365 TGTGATCTCAACACTTTGGGAGG - Intergenic
1001708998 5:173762813-173762835 TGTAATCTCCACACTTTGGGAGG + Intergenic
1002203034 5:177541874-177541896 AGTAATCTGGAGATTGTGGGAGG - Intronic
1002557052 5:180050417-180050439 ATTGCTCTCCATAATGTGGGTGG - Intronic
1002891691 6:1338310-1338332 TGTAATCTCAACACTGTGGGAGG + Intergenic
1003246658 6:4387717-4387739 CGTGATCTCCAGGCTGGTGGTGG - Intergenic
1004254948 6:14054871-14054893 AGTGATATGCAGACAGTGGTGGG - Intergenic
1006269817 6:32955575-32955597 AGTCAACTCCAGATTGTGGTGGG + Intronic
1006551326 6:34825561-34825583 TGTGATCCCCACACTTTGGGAGG - Intronic
1006956325 6:37875925-37875947 TGTAATCTCCACACTTTGGGAGG - Intronic
1007750141 6:44066475-44066497 AGGGATCCCCAGTCTGAGGGGGG - Intergenic
1009442888 6:63703132-63703154 TGTGATCCCCACACTTTGGGAGG - Intronic
1010186220 6:73146366-73146388 TGTGATCCCCACACTTTGGGAGG + Intronic
1010231355 6:73538282-73538304 TGTAATCTCAGGACTGTGGGAGG - Intergenic
1010955658 6:82088107-82088129 AGTGATCTCCAGGCAGAGGCAGG + Intergenic
1011016775 6:82765209-82765231 AGAGTTCTCCAGACTGTGAGAGG + Intergenic
1011957808 6:93045031-93045053 AGTTATCTTCAGGCTTTGGGCGG + Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1013045874 6:106484574-106484596 TGTAATCCCCAGACTTTGGGAGG - Intergenic
1013088515 6:106876987-106877009 AGTGAAGTCCAGACTGAGGAGGG - Intergenic
1013229228 6:108146478-108146500 ATTGCTCTCCACAATGTGGGTGG + Intronic
1013465154 6:110411390-110411412 TGTCATCTCCAAATTGTGGGAGG - Intronic
1014069648 6:117166765-117166787 ATTGCCCTCCAGAATGTGGGTGG + Intergenic
1015225656 6:130853979-130854001 AGTGAGCTGCAGCCAGTGGGGGG + Intronic
1016480529 6:144476208-144476230 TGTGATCTCCACGCTTTGGGAGG - Intronic
1016741555 6:147534078-147534100 GGTCATGTCCACACTGTGGGAGG - Intronic
1017469867 6:154728969-154728991 TGTAATCTCAACACTGTGGGAGG - Intergenic
1018002747 6:159594247-159594269 AGTGGTCTCCAAACTGGGGTAGG - Intergenic
1019069997 6:169337498-169337520 TGTAATCTCCACACTTTGGGCGG - Intergenic
1019393412 7:802601-802623 TGTGATCCCAACACTGTGGGAGG + Intergenic
1019500854 7:1364148-1364170 GGTGCTCTCCAGACAGGGGGCGG + Intergenic
1019568454 7:1696656-1696678 AGTAATCTCAACACTTTGGGAGG - Intronic
1019766649 7:2856247-2856269 TGTGATCCCCACACTTTGGGAGG - Intergenic
1022958753 7:35404838-35404860 AGTGATTTCCAGAGTAGGGGTGG - Intergenic
1024156206 7:46628388-46628410 AATGCCCTCCAGACTGTGGGGGG + Intergenic
1026509144 7:71013468-71013490 ACTGCACTCCAGCCTGTGGGGGG + Intergenic
1026539927 7:71270813-71270835 GCTGAACTTCAGACTGTGGGAGG - Intronic
1026680610 7:72463815-72463837 TGTAATCTCCACACTTTGGGAGG - Intergenic
1027172200 7:75880427-75880449 AGTGAACCCCAGAAAGTGGGAGG - Intronic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1027762327 7:82295610-82295632 AGTAATCTCAACACTTTGGGAGG - Intronic
1029540868 7:101181111-101181133 AGTGAGCTCAAGACTGGGTGCGG + Intergenic
1029646995 7:101863605-101863627 TGTAATCCCCACACTGTGGGAGG - Intronic
1031226928 7:119051200-119051222 ATTGATCTCCATAATGTGGGTGG + Intergenic
1032300218 7:130679778-130679800 TGTAATCTCCATACTTTGGGAGG - Intronic
1033237392 7:139649160-139649182 TGTGGTGTCCAGTCTGTGGGAGG - Intronic
1033402852 7:141043343-141043365 TGTAATCTCAACACTGTGGGAGG + Intergenic
1034949610 7:155288089-155288111 CCTGATCTCCAGTCTGTGGCTGG + Intergenic
1036371721 8:8168226-8168248 AGTAATCTCAGGACTTTGGGAGG + Intergenic
1036822497 8:11951928-11951950 AGGGATCTCTGGAGTGTGGGAGG - Intergenic
1036879180 8:12497418-12497440 AGTAATCTCAGGACTTTGGGAGG - Intergenic
1036915099 8:12796990-12797012 AGTCATCTGCAGGATGTGGGTGG + Intergenic
1037103212 8:15073592-15073614 ACTGCTCTCCATAATGTGGGTGG + Intronic
1038874971 8:31538562-31538584 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1039582632 8:38679479-38679501 TGTGATCTCAACACTTTGGGAGG + Intergenic
1039584019 8:38690469-38690491 TGTAATCTCTACACTGTGGGAGG - Intergenic
1039936706 8:42051985-42052007 AGTGAGCTCCAGCCGGGGGGAGG + Exonic
1040036546 8:42875829-42875851 AGTAATCTCCACACTTTGGGAGG - Intronic
1042327938 8:67547748-67547770 AGTGATCCCAACACTTTGGGAGG - Intronic
1044034187 8:87277331-87277353 ATTGCCCTCCATACTGTGGGTGG - Intronic
1044190689 8:89313316-89313338 AATGATCTCCAGCCTGAGGGGGG + Intergenic
1045872129 8:106939137-106939159 AGTGATGGCCAGGCTGTGTGAGG + Intergenic
1046501484 8:115083487-115083509 ACTGCTCTCCATAATGTGGGTGG - Intergenic
1047962508 8:130021163-130021185 CGTCATCTCAGGACTGTGGGGGG + Intergenic
1048216699 8:132502137-132502159 TGTGAGCTCCAGGCTGTGGGAGG - Intergenic
1049082544 8:140454680-140454702 TGTGATCTCAACACTTTGGGAGG + Intronic
1049575117 8:143386311-143386333 AGTGCTCTGGGGACTGTGGGAGG - Intergenic
1050253174 9:3767391-3767413 ATTTGTCTCCAGTCTGTGGGTGG + Intergenic
1050531832 9:6597472-6597494 AGTGATCCCAACACTTTGGGAGG + Intronic
1051490140 9:17654093-17654115 AGAGAGCTGCAGACTGGGGGAGG + Intronic
1053569704 9:39291356-39291378 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1054091335 9:60850361-60850383 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1054112750 9:61125931-61125953 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1054127444 9:61327657-61327679 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1054594965 9:67056215-67056237 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1055383168 9:75731355-75731377 AGTGCTCTCCTCAATGTGGGTGG + Intergenic
1055680212 9:78706604-78706626 AGTAATCCCCACACTTTGGGAGG - Intergenic
1056292665 9:85159323-85159345 GGTGTTTTTCAGACTGTGGGTGG + Intergenic
1056864756 9:90219756-90219778 GGTCATATCCAGAGTGTGGGAGG - Intergenic
1057320875 9:94011331-94011353 TGTGCCCTCCAGACTGTGGCAGG - Intergenic
1057366850 9:94430477-94430499 TGTGATTGCAAGACTGTGGGAGG - Intronic
1057415507 9:94858790-94858812 AGTAATCTCAGCACTGTGGGAGG + Intronic
1057656486 9:96957588-96957610 TGTGATTGCAAGACTGTGGGAGG + Intronic
1058091295 9:100808656-100808678 AGTGATCTCCAGCCTCTGCTTGG - Intergenic
1060615188 9:125006744-125006766 TGTAATCCCCACACTGTGGGAGG - Intronic
1060800719 9:126544013-126544035 AGCGATCTCCAGACTATAGTTGG + Intergenic
1061134861 9:128727972-128727994 TGTAATCTCAACACTGTGGGTGG + Intergenic
1062145801 9:134989030-134989052 AGGGGTGTCCAGACTGTGTGAGG + Intergenic
1062605259 9:137344772-137344794 GGAGATCTCCAGACAGTGGAAGG - Intronic
1062605269 9:137344860-137344882 GGAGATCTCCAGACAGTGGAAGG - Intronic
1062605279 9:137344948-137344970 GGAGATCTCCAGACAGTGGAAGG - Intronic
1062605289 9:137345036-137345058 GGGGATCTCCAGACAGTGGAAGG - Intronic
1186890183 X:13951974-13951996 AGTGGGCTCCAGAGAGTGGGAGG - Intergenic
1186963504 X:14762401-14762423 TGTAATCTCAACACTGTGGGAGG - Intergenic
1187007458 X:15246731-15246753 TGTAATCTCCACACTTTGGGAGG - Intronic
1188328321 X:28835368-28835390 AGAGATTTCCAGGCTGTGTGAGG + Intronic
1188859557 X:35241027-35241049 ATTGCTCTCCATAATGTGGGTGG - Intergenic
1190341721 X:49302136-49302158 AGTAATCTCAGCACTGTGGGAGG - Intergenic
1192360590 X:70436354-70436376 AGTGACCTCCATATTGTGCGTGG - Intergenic
1197224190 X:123940174-123940196 TGTAATCTCCACACTTTGGGAGG - Intergenic
1197860843 X:130968613-130968635 AGTGATTTCCAGGATCTGGGGGG + Intergenic
1197875454 X:131099454-131099476 TGTGATCCCCACACTTTGGGAGG - Intergenic
1200051755 X:153435957-153435979 ATTGTTCTCCATGCTGTGGGTGG + Intergenic
1201303750 Y:12533257-12533279 AGTAATCTCAACACTTTGGGAGG - Intergenic