ID: 951080199

View in Genome Browser
Species Human (GRCh38)
Location 3:18444253-18444275
Sequence TTTTCTAAAAGGGGCCATAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 150}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951080183_951080199 24 Left 951080183 3:18444206-18444228 CCCCTTTTCCCCATTTGCTTCCT 0: 1
1: 0
2: 14
3: 80
4: 929
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150
951080191_951080199 -9 Left 951080191 3:18444239-18444261 CCACTCCCCTTTCCTTTTCTAAA 0: 1
1: 0
2: 8
3: 142
4: 956
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150
951080184_951080199 23 Left 951080184 3:18444207-18444229 CCCTTTTCCCCATTTGCTTCCTT 0: 1
1: 0
2: 6
3: 154
4: 1156
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150
951080185_951080199 22 Left 951080185 3:18444208-18444230 CCTTTTCCCCATTTGCTTCCTTC 0: 1
1: 0
2: 11
3: 121
4: 1105
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150
951080189_951080199 14 Left 951080189 3:18444216-18444238 CCATTTGCTTCCTTCGGTCTTTT 0: 1
1: 0
2: 2
3: 59
4: 616
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150
951080190_951080199 4 Left 951080190 3:18444226-18444248 CCTTCGGTCTTTTCCACTCCCCT 0: 1
1: 1
2: 1
3: 17
4: 281
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150
951080188_951080199 15 Left 951080188 3:18444215-18444237 CCCATTTGCTTCCTTCGGTCTTT 0: 1
1: 0
2: 1
3: 23
4: 376
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150
951080187_951080199 16 Left 951080187 3:18444214-18444236 CCCCATTTGCTTCCTTCGGTCTT 0: 1
1: 0
2: 0
3: 22
4: 452
Right 951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG 0: 1
1: 0
2: 0
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951080199 Original CRISPR TTTTCTAAAAGGGGCCATAC CGG Intronic
902188280 1:14741743-14741765 TTGTCTTCAAGGGGCCATTCTGG - Intronic
904080313 1:27868415-27868437 TTGTCTCAGAGGGGCCATGCAGG + Intergenic
905941558 1:41867286-41867308 TTTTCTATAAAGGGCCAGAAAGG + Intronic
908609042 1:65835640-65835662 TTTTTTAAATGTGGCCAAACTGG - Intronic
911059276 1:93733689-93733711 TGTTCTAAGAGTGCCCATACAGG - Intronic
911878539 1:103201907-103201929 TTGACTAAAAGGGGACATACAGG + Intergenic
917715523 1:177733319-177733341 TTTTTTAAAAGGGGATCTACTGG + Intergenic
921827898 1:219694454-219694476 TTGTATAAAAGGAGGCATACAGG - Intronic
922381360 1:225031482-225031504 TTTTCTGTAAGGGGCCAGACAGG - Intronic
924094806 1:240540314-240540336 TTCTCCAAAAGGGGGCATAAAGG + Intronic
924097644 1:240570549-240570571 TTTATTAAAAGGGGGCATACTGG - Intronic
924839913 1:247697904-247697926 TTTTCTAACAGGGTACACACAGG - Intergenic
1063306817 10:4910072-4910094 TTTTCTAAAAGGGGGAAAAAAGG - Intergenic
1066217535 10:33302336-33302358 TTTACGCAAAGGGGCCAAACAGG - Intronic
1066658199 10:37713605-37713627 TTTTTTAAAAAGGCCCAGACAGG - Intergenic
1067818949 10:49509798-49509820 TTTTCTAAAAGGGTAAATATTGG - Intronic
1068468614 10:57429724-57429746 TTTTCCAAAATGGGCTATTCAGG - Intergenic
1072199277 10:93144187-93144209 CTTTCCAAAGGGGGCCAGACTGG + Intergenic
1074911471 10:117913686-117913708 ATTTCTAAAAGGGGAGTTACTGG - Intergenic
1079640861 11:22803801-22803823 TATTCTGAAAAGGGACATACAGG + Intronic
1079640875 11:22803946-22803968 TATTCTGAAAAGGGACATACAGG + Intronic
1079844778 11:25451596-25451618 TGTTCTTAAAAGGCCCATACTGG - Intergenic
1086072321 11:82813006-82813028 TTTTCACAAAGGGGCCATAAAGG + Intergenic
1086162762 11:83741706-83741728 TATTATAAAAATGGCCATACTGG + Intronic
1086988350 11:93274578-93274600 TTTTTTAAATGGCGCAATACAGG + Intergenic
1090055105 11:123416615-123416637 TTTTCTAAACAGTGCCACACAGG - Intergenic
1090511591 11:127381203-127381225 TTTCCTAATAGGGGAGATACTGG + Intergenic
1093703366 12:22247697-22247719 TTTTATAAAAGAAGCCATAAAGG + Intronic
1093957054 12:25232343-25232365 TTTTCTATAAAGGGCCATATGGG - Intronic
1095271417 12:40224440-40224462 ATTCCTAAAAGGGGCCATCTGGG + Intronic
1098054258 12:66487219-66487241 TTTTTTAAAAAGGGGCATACAGG + Intronic
1098325345 12:69296577-69296599 TTTTTTGACAGTGGCCATACTGG - Intergenic
1100812347 12:98351684-98351706 CTGTCTAAAAGTGGCCATATGGG - Intergenic
1101244102 12:102868923-102868945 CTTTCTACAAGGTGCCTTACAGG - Intronic
1101408584 12:104451240-104451262 TCTTATAAAAGGAACCATACTGG - Intergenic
1102706322 12:114883973-114883995 TTTTTTAAAAGGGGACATCTAGG - Intergenic
1105497502 13:20943755-20943777 TTTTCTAGAAGGATCCATTCAGG + Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107722928 13:43267708-43267730 TCTTGCAAAAGGGGCCATGCAGG - Intronic
1108612905 13:52101553-52101575 TTTTCTAAAAGAGGATAGACTGG - Intronic
1108847295 13:54693577-54693599 TTTGCTAAAAATGGCCAAACAGG - Intergenic
1109262299 13:60158890-60158912 TTTTTTAAGAGGGGCCAGGCAGG - Intronic
1113325296 13:109275715-109275737 CTTGCTAAAATGGGCCATAGAGG + Intergenic
1114058270 14:18994852-18994874 TTTTCTAATAGTGGCCATTCTGG + Intronic
1114104276 14:19406902-19406924 TTTTCTAATAGTGGCCATTCTGG - Intronic
1120632430 14:86906378-86906400 TTTTCTAAGAGGGGGCAATCAGG - Intronic
1121110048 14:91306590-91306612 TTTTCTAGAAAGGGCCAGATAGG + Intronic
1127010570 15:54621950-54621972 TTTTCCACAATGTGCCATACCGG - Intronic
1127939086 15:63675383-63675405 CTTTCTGTAAGGGGCCAGACAGG + Intronic
1128295593 15:66516240-66516262 GTTTCTAACAGGGGCACTACTGG - Intronic
1130037266 15:80372270-80372292 TTTCCTAAAAGGGGCTATTTTGG + Intronic
1133493446 16:6294201-6294223 TTTTCTGCATGGGGCCAAACAGG + Intronic
1134844287 16:17426771-17426793 TTTTCTGTAAAGGGCCAGACAGG - Intronic
1135382592 16:22007637-22007659 TTTGCTAAATGGGGCAATCCTGG + Intronic
1135644614 16:24150789-24150811 TTCTCTATAAAGGGCCAAACAGG - Intronic
1137863141 16:51866752-51866774 TTTTCCAAAAGGGTCCATTTCGG - Intergenic
1139176024 16:64688719-64688741 TTTTCTAAAAAGGGCCAGAGGGG - Intergenic
1140168239 16:72576816-72576838 TTTTCTTAAAGTTGCCATGCGGG + Intergenic
1142329049 16:89438640-89438662 TTTTCTAAAAAAAGACATACTGG + Intronic
1143237872 17:5418880-5418902 TTTTCTAAAGCGGGCGTTACGGG + Intronic
1153861189 18:9209509-9209531 TTTTTAAAAAGAGGCAATACAGG - Intronic
1158816357 18:61102089-61102111 TTTTTTAATAATGGCCATACTGG + Intergenic
1158839772 18:61372812-61372834 TTTTCTATAAGGGGCCAGAGAGG - Intronic
1159123876 18:64200788-64200810 TTTTGTAGAAGGGGCCTTTCTGG + Intergenic
1160712410 19:558664-558686 TTTGCTAAATGAGGCCCTACAGG + Intergenic
1161761824 19:6179119-6179141 TCTTCTACAAGCTGCCATACAGG + Intronic
1163562524 19:18028496-18028518 TTTTCTATAAAGGGCCAGATAGG + Intergenic
1165116871 19:33533864-33533886 TGTTCTGGAAGGGGCCATGCTGG - Intergenic
1166300988 19:41912218-41912240 GTTTCTAGAAGGGGTCACACTGG - Intronic
925940997 2:8818537-8818559 TTTTTTAAAAGGAGTAATACAGG - Intronic
927277338 2:21273097-21273119 TTTTCCTAAAGGGGGCAGACAGG + Intergenic
928833326 2:35515142-35515164 TTTTCTAAATGGGGAAATAAAGG - Intergenic
929567471 2:42998883-42998905 TTTTCTAAAACCAGCCACACTGG + Intergenic
932234739 2:70111889-70111911 TTTTTTAAAATGTGCCACACTGG - Intergenic
932579115 2:72982197-72982219 TTTTATAGACGGGGCCATAATGG + Intronic
935231112 2:101097063-101097085 TGTTCTAAAAGAAGCCATAGGGG + Intronic
936555825 2:113498185-113498207 TTTTCAAACTGGGCCCATACTGG + Intergenic
936866508 2:117080852-117080874 TTTTCTATAAAAGGCCAGACAGG - Intergenic
938282935 2:130079368-130079390 ATTTCTAATAGTGGCCATTCTGG - Intronic
938333568 2:130467930-130467952 ATTTCTAATAGTGGCCATTCTGG - Intronic
938356245 2:130652735-130652757 ATTTCTAATAGTGGCCATTCTGG + Intronic
938432677 2:131259538-131259560 ATTTCTAATAGTGGCCATTCTGG + Intronic
938476685 2:131621788-131621810 ATTTCTAATAGTGGCCATTCTGG + Intergenic
940365109 2:152839603-152839625 TTTTCTAATAATGGCCATTCTGG + Intergenic
948107930 2:235430086-235430108 TTTCCCAGAAGGGGACATACTGG - Intergenic
1170647925 20:18213261-18213283 TATTCTAGAAAGGGCCAGACAGG - Intergenic
1170815889 20:19713959-19713981 TTTTCTACAAGGGGCCAGAGAGG + Intronic
1176897406 21:14397622-14397644 TTATCTAAAAGGCCCCACACTGG + Intergenic
1178304458 21:31479852-31479874 TTTTCTAAAAGAGGGAAAACAGG - Intronic
1178901354 21:36601439-36601461 TTTTCTAGAAAGGGCCAGATGGG + Intergenic
1180476758 22:15717470-15717492 TTTTCTAATAGTGGCCATTCTGG + Intronic
1184624242 22:45710794-45710816 TTTTCCATAAAGGGCCAGACAGG - Intronic
951080199 3:18444253-18444275 TTTTCTAAAAGGGGCCATACCGG + Intronic
952069181 3:29612656-29612678 TATTCTAAAAAGGGCCTTAAAGG - Intronic
952519034 3:34136588-34136610 TTTTTTAAAAGAAGACATACAGG + Intergenic
952764543 3:36943645-36943667 TTTTCTATAAAGGACCAAACAGG + Intronic
953443163 3:42936963-42936985 TTTTCCAAAATGGGACATCCTGG - Exonic
957819264 3:85349060-85349082 TTTCAGAACAGGGGCCATACAGG - Intronic
965325605 3:167300169-167300191 ATTTATAAAAGGGGCAATCCTGG + Intronic
971549779 4:27937940-27937962 TTAACTAAAAGGGGCCATTCTGG - Intergenic
971665438 4:29478226-29478248 TTTTCTAAGAAAGGACATACAGG + Intergenic
976621550 4:87133425-87133447 TTTTTTAAGAGAGGCCATATGGG - Intronic
976626397 4:87188543-87188565 TATTCTAAAAGGGTACATAGGGG - Intronic
980487663 4:133479929-133479951 TTTTCTAAAAGAAGACATACAGG - Intergenic
983808088 4:172019276-172019298 TTTTTCAAAAGAGGACATACAGG - Intronic
985122046 4:186653846-186653868 GTTTCTATAAAGGGCCACACGGG - Intronic
987339858 5:16930237-16930259 GTTTCAAAAAGGAGCCAGACAGG + Intronic
988943982 5:36175891-36175913 TTTTCTAAAAGTGGAATTACTGG + Intronic
989896517 5:47094157-47094179 TTTTCTAAAAGAGGTCTTAAAGG + Intergenic
989896902 5:47101754-47101776 TTTTCTACAAGGGGCCTTAAAGG + Intergenic
990670934 5:58129364-58129386 TTTTCTGAAAAGGGCCAAATAGG + Intergenic
991551568 5:67842684-67842706 TTTTTTAAAAATAGCCATACTGG + Intergenic
991568468 5:68029846-68029868 TTTTTTAAAAAGGGCTATATAGG - Intergenic
994554359 5:101279190-101279212 TTTTCTAAAACGGAGCATAATGG + Intergenic
997231759 5:132250576-132250598 TTTTCTTAAAGGGGATATATTGG + Intronic
1001084109 5:168687958-168687980 TTGTCTAGAAGGGGCAATAATGG - Intronic
1002024185 5:176385540-176385562 CTTTCCAAAAGTTGCCATACTGG - Intronic
1202772195 5_GL000208v1_random:17515-17537 TTTTCTAAAAGAGGCCTTAAAGG + Intergenic
1202772513 5_GL000208v1_random:23958-23980 TTTTCTACAAGGGGCCTTAAAGG + Intergenic
1002773498 6:309003-309025 TTTTCTAAAATGTCCCATGCTGG + Intronic
1004207432 6:13605354-13605376 TTTTCTGTAAAGGGCCACACAGG - Intronic
1009910597 6:69922020-69922042 TGTTATAAAAGAGGCCATATTGG - Intronic
1010143553 6:72639504-72639526 TTTTTCAAAAGGGACCATGCAGG + Intronic
1011381091 6:86743038-86743060 TTTTCTAAACAGTGACATACAGG - Intergenic
1012260484 6:97082273-97082295 TTATCTAAAAGAGGAGATACAGG + Intronic
1012275144 6:97264016-97264038 TTTTCTATAAAGGGCCAGATAGG + Intronic
1012611310 6:101223907-101223929 ATTACTAAAAGGAGACATACGGG - Intergenic
1013980007 6:116119513-116119535 ATTGATGAAAGGGGCCATACAGG + Exonic
1014801267 6:125780489-125780511 TTTTCCTTAAGGGGCCATCCCGG - Intergenic
1015075089 6:129147278-129147300 TTTTCAAAAAGGCTCCAAACTGG + Intronic
1015760380 6:136653372-136653394 TTTTCTAAAATAGGCCATCCTGG + Intronic
1015964603 6:138685548-138685570 TTAGCTAAAAGAGCCCATACAGG + Intronic
1016528719 6:145034784-145034806 TTTTCTGTAAGGGGCCATAGAGG + Intergenic
1017754694 6:157519513-157519535 TTTTCTAAAAGGTGCCGTCTTGG + Intronic
1019890397 7:3941496-3941518 TTTTCCCAAATGGGCCAAACGGG + Intronic
1020791016 7:12628244-12628266 GTTTTTAAAAGGTGCCATCCAGG - Intronic
1023623285 7:42093793-42093815 TTTTCTGAAAGCTCCCATACAGG - Intronic
1024864180 7:53884833-53884855 TTTTCTAAAAGTAACCATCCTGG - Intergenic
1028437060 7:90816082-90816104 TTTTAAAAAAAGGGCCATAGTGG + Intronic
1029349173 7:100000839-100000861 TTTTCTATAAAGGGCCAGATAGG + Intergenic
1033830333 7:145243640-145243662 TTTTATAAAAGGGGAAATTCAGG + Intergenic
1038611434 8:29063181-29063203 GTTTCTAAGATGGGCCATGCGGG + Intronic
1039329404 8:36520532-36520554 TTTTATAAAAGGGTTGATACAGG - Intergenic
1040507884 8:48067941-48067963 TTTTTTAAAAGAGGTCATATGGG + Intergenic
1040674997 8:49738256-49738278 TTGTCCAAATGTGGCCATACTGG - Intergenic
1044054262 8:87548908-87548930 CTTTCTAAAAATGGCCATTCTGG + Intronic
1048567711 8:135620630-135620652 TTTTCTAAAATGGTGCAAACAGG + Intronic
1049173665 8:141177830-141177852 TTTTCTAGAAGGGGCTAGGCAGG - Intronic
1049404755 8:142447410-142447432 TTTTCTAAAAGGGGCGAGTTGGG + Intergenic
1049897197 9:119167-119189 TTTTCAAACTGGGCCCATACTGG - Intergenic
1052105124 9:24504999-24505021 TTTTCTAAAACTAGTCATACTGG - Intergenic
1053740299 9:41129432-41129454 TTTTCAAACTGGGCCCATACTGG - Intergenic
1054443264 9:65285425-65285447 TTTTCAAACTGGGCCCATACTGG - Intergenic
1054487016 9:65736076-65736098 TTTTCAAACTGGGCCCATACTGG + Intergenic
1054688050 9:68301881-68301903 TTTTCAAACTGGGCCCATACTGG + Intergenic
1055072388 9:72180061-72180083 TTTTTTAAAAATGGCCATCCGGG + Intronic
1055153643 9:73034739-73034761 TTTTCTAAAAGGAGCCAATACGG + Intronic
1055185449 9:73447026-73447048 TTTATTAAGAAGGGCCATACTGG - Intergenic
1059177190 9:112177930-112177952 TTTGCTAATAGGTGCCAAACTGG - Intergenic
1059573053 9:115460816-115460838 ATGTCTAAAATGGGTCATACAGG - Intergenic
1061651817 9:132056643-132056665 TTTTCTGAAAGAGCTCATACAGG - Intronic
1203357807 Un_KI270442v1:176938-176960 TTTTCTAAAATAGGCCACAAAGG - Intergenic
1186086722 X:5998459-5998481 TTTTCTTAAAGGAACCATAGGGG - Intronic
1187152226 X:16691904-16691926 TTTTCTCAAAAGGGCCAGATGGG + Intronic
1189055489 X:37695167-37695189 TTTTCTAAAAATGGCCACAGTGG - Intronic
1190020712 X:46871371-46871393 TTTTCTGTAAAGGGCCAGACAGG - Intronic
1195622799 X:106974273-106974295 TTTTCTGAAAAGGGCCAGAAAGG - Intronic
1195749973 X:108154403-108154425 TTTTCTGTAAAGGGCCAGACGGG + Exonic
1198033514 X:132778765-132778787 TTTTCTAAAAGTTGCCTTAAAGG + Intronic
1201738279 Y:17295453-17295475 TTTTAAAAAAGAGGTCATACAGG + Intergenic