ID: 951082383

View in Genome Browser
Species Human (GRCh38)
Location 3:18467382-18467404
Sequence AAGCCTATGCTGCTAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951082383_951082387 12 Left 951082383 3:18467382-18467404 CCAGAAACTAGCAGCATAGGCTT No data
Right 951082387 3:18467417-18467439 TGTTAGAAATGCAGATACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951082383 Original CRISPR AAGCCTATGCTGCTAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr