ID: 951083361

View in Genome Browser
Species Human (GRCh38)
Location 3:18479210-18479232
Sequence CCTATTCTACACCAAGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951083356_951083361 3 Left 951083356 3:18479184-18479206 CCAGGGAAGCCAAAAGATTGGAC 0: 680
1: 1004
2: 719
3: 347
4: 250
Right 951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG No data
951083355_951083361 4 Left 951083355 3:18479183-18479205 CCCAGGGAAGCCAAAAGATTGGA 0: 728
1: 1007
2: 643
3: 334
4: 297
Right 951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG No data
951083349_951083361 30 Left 951083349 3:18479157-18479179 CCAAGGCAATTCTTTTTCCAGTG No data
Right 951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG No data
951083357_951083361 -6 Left 951083357 3:18479193-18479215 CCAAAAGATTGGACGCCCCTATT No data
Right 951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG No data
951083353_951083361 13 Left 951083353 3:18479174-18479196 CCAGTGTGGCCCAGGGAAGCCAA 0: 293
1: 839
2: 851
3: 560
4: 459
Right 951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951083361 Original CRISPR CCTATTCTACACCAAGAGTT AGG Intergenic
No off target data available for this crispr