ID: 951087999

View in Genome Browser
Species Human (GRCh38)
Location 3:18537487-18537509
Sequence CAGGCACATGCTGCTGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951087988_951087999 26 Left 951087988 3:18537438-18537460 CCTGGGTTAAGTGATTCTCCTGC 0: 29
1: 1196
2: 38847
3: 89267
4: 108658
Right 951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG No data
951087987_951087999 29 Left 951087987 3:18537435-18537457 CCTCCTGGGTTAAGTGATTCTCC 0: 13
1: 122
2: 577
3: 2717
4: 6407
Right 951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG No data
951087991_951087999 4 Left 951087991 3:18537460-18537482 CCTCACCCTCCAGAGTAGCTGGG 0: 84
1: 10436
2: 212167
3: 274942
4: 179616
Right 951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG No data
951087994_951087999 -2 Left 951087994 3:18537466-18537488 CCTCCAGAGTAGCTGGGATTACA 0: 4414
1: 109521
2: 249523
3: 225351
4: 156218
Right 951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG No data
951087996_951087999 -5 Left 951087996 3:18537469-18537491 CCAGAGTAGCTGGGATTACAGGC 0: 72761
1: 205379
2: 228437
3: 173801
4: 346072
Right 951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG No data
951087989_951087999 8 Left 951087989 3:18537456-18537478 CCTGCCTCACCCTCCAGAGTAGC 0: 58
1: 8495
2: 184096
3: 239382
4: 166103
Right 951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG No data
951087993_951087999 -1 Left 951087993 3:18537465-18537487 CCCTCCAGAGTAGCTGGGATTAC 0: 64
1: 1470
2: 3405
3: 4333
4: 4699
Right 951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951087999 Original CRISPR CAGGCACATGCTGCTGGGCT CGG Intergenic
No off target data available for this crispr