ID: 951090051

View in Genome Browser
Species Human (GRCh38)
Location 3:18561889-18561911
Sequence CTGTAATAGTTGAGTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951090051_951090054 19 Left 951090051 3:18561889-18561911 CCTTCTTGACTCAACTATTACAG No data
Right 951090054 3:18561931-18561953 TTTTTCTTCCCTTCTCAATTTGG No data
951090051_951090055 20 Left 951090051 3:18561889-18561911 CCTTCTTGACTCAACTATTACAG No data
Right 951090055 3:18561932-18561954 TTTTCTTCCCTTCTCAATTTGGG No data
951090051_951090053 -9 Left 951090051 3:18561889-18561911 CCTTCTTGACTCAACTATTACAG No data
Right 951090053 3:18561903-18561925 CTATTACAGGCTCACTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951090051 Original CRISPR CTGTAATAGTTGAGTCAAGA AGG (reversed) Intergenic
No off target data available for this crispr