ID: 951090053

View in Genome Browser
Species Human (GRCh38)
Location 3:18561903-18561925
Sequence CTATTACAGGCTCACTACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951090050_951090053 17 Left 951090050 3:18561863-18561885 CCTGAGCAAATGTCTTTTTCTTC No data
Right 951090053 3:18561903-18561925 CTATTACAGGCTCACTACTTAGG No data
951090051_951090053 -9 Left 951090051 3:18561889-18561911 CCTTCTTGACTCAACTATTACAG No data
Right 951090053 3:18561903-18561925 CTATTACAGGCTCACTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951090053 Original CRISPR CTATTACAGGCTCACTACTT AGG Intergenic
No off target data available for this crispr