ID: 951090054

View in Genome Browser
Species Human (GRCh38)
Location 3:18561931-18561953
Sequence TTTTTCTTCCCTTCTCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951090051_951090054 19 Left 951090051 3:18561889-18561911 CCTTCTTGACTCAACTATTACAG No data
Right 951090054 3:18561931-18561953 TTTTTCTTCCCTTCTCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951090054 Original CRISPR TTTTTCTTCCCTTCTCAATT TGG Intergenic
No off target data available for this crispr