ID: 951090055

View in Genome Browser
Species Human (GRCh38)
Location 3:18561932-18561954
Sequence TTTTCTTCCCTTCTCAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951090051_951090055 20 Left 951090051 3:18561889-18561911 CCTTCTTGACTCAACTATTACAG No data
Right 951090055 3:18561932-18561954 TTTTCTTCCCTTCTCAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951090055 Original CRISPR TTTTCTTCCCTTCTCAATTT GGG Intergenic
No off target data available for this crispr