ID: 951093562

View in Genome Browser
Species Human (GRCh38)
Location 3:18602042-18602064
Sequence CTTACTCAGCACATCTTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951093561_951093562 -10 Left 951093561 3:18602029-18602051 CCTTAATGTGAAACTTACTCAGC No data
Right 951093562 3:18602042-18602064 CTTACTCAGCACATCTTCCTAGG No data
951093557_951093562 30 Left 951093557 3:18601989-18602011 CCAAAAAAAAAAAAAACAGTTAA No data
Right 951093562 3:18602042-18602064 CTTACTCAGCACATCTTCCTAGG No data
951093560_951093562 -9 Left 951093560 3:18602028-18602050 CCCTTAATGTGAAACTTACTCAG No data
Right 951093562 3:18602042-18602064 CTTACTCAGCACATCTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951093562 Original CRISPR CTTACTCAGCACATCTTCCT AGG Intergenic
No off target data available for this crispr