ID: 951095446

View in Genome Browser
Species Human (GRCh38)
Location 3:18624497-18624519
Sequence ATACTACCAATCTTTGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951095446_951095448 -2 Left 951095446 3:18624497-18624519 CCTATGTCAAAGATTGGTAGTAT No data
Right 951095448 3:18624518-18624540 ATATTGATAATGGAAAACACTGG No data
951095446_951095449 23 Left 951095446 3:18624497-18624519 CCTATGTCAAAGATTGGTAGTAT No data
Right 951095449 3:18624543-18624565 TTTACCTATTCCCCCATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951095446 Original CRISPR ATACTACCAATCTTTGACAT AGG (reversed) Intergenic
No off target data available for this crispr