ID: 951100389

View in Genome Browser
Species Human (GRCh38)
Location 3:18681529-18681551
Sequence TTGGTTTTACTAAGAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951100389_951100392 12 Left 951100389 3:18681529-18681551 CCTGTGTTTCTTAGTAAAACCAA No data
Right 951100392 3:18681564-18681586 CATGTGAACCTACAATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951100389 Original CRISPR TTGGTTTTACTAAGAAACAC AGG (reversed) Intergenic
No off target data available for this crispr