ID: 951109378

View in Genome Browser
Species Human (GRCh38)
Location 3:18784126-18784148
Sequence CTCTGTATAAGTACCCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951109373_951109378 27 Left 951109373 3:18784076-18784098 CCTCTTCTTTGCTCCAAAGGGAG No data
Right 951109378 3:18784126-18784148 CTCTGTATAAGTACCCTGAAGGG No data
951109374_951109378 14 Left 951109374 3:18784089-18784111 CCAAAGGGAGACACTGTCTCTAT No data
Right 951109378 3:18784126-18784148 CTCTGTATAAGTACCCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951109378 Original CRISPR CTCTGTATAAGTACCCTGAA GGG Intergenic
No off target data available for this crispr