ID: 951111865

View in Genome Browser
Species Human (GRCh38)
Location 3:18813228-18813250
Sequence CTCTACGTGGTCCCTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951111865_951111868 -4 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111868 3:18813247-18813269 AGAGGACAACCAAATCATCATGG No data
951111865_951111870 14 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111870 3:18813265-18813287 CATGGCCAAATCCAGCCCTAAGG No data
951111865_951111874 29 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111874 3:18813280-18813302 CCCTAAGGCTCCAGACATGTAGG No data
951111865_951111876 30 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111876 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951111865 Original CRISPR CTCTACGTGGTCCCTTCATG TGG (reversed) Intergenic