ID: 951111867

View in Genome Browser
Species Human (GRCh38)
Location 3:18813241-18813263
Sequence TGATTTGGTTGTCCTCTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951111867_951111874 16 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111874 3:18813280-18813302 CCCTAAGGCTCCAGACATGTAGG No data
951111867_951111876 17 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111876 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG No data
951111867_951111870 1 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111870 3:18813265-18813287 CATGGCCAAATCCAGCCCTAAGG No data
951111867_951111878 30 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111878 3:18813294-18813316 ACATGTAGGGCAGCCCTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951111867 Original CRISPR TGATTTGGTTGTCCTCTACG TGG (reversed) Intergenic