ID: 951111868

View in Genome Browser
Species Human (GRCh38)
Location 3:18813247-18813269
Sequence AGAGGACAACCAAATCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951111865_951111868 -4 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111868 3:18813247-18813269 AGAGGACAACCAAATCATCATGG No data
951111861_951111868 26 Left 951111861 3:18813198-18813220 CCAAAGAGACAAGGAGTGTGAGA No data
Right 951111868 3:18813247-18813269 AGAGGACAACCAAATCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951111868 Original CRISPR AGAGGACAACCAAATCATCA TGG Intergenic