ID: 951111868 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:18813247-18813269 |
Sequence | AGAGGACAACCAAATCATCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
951111865_951111868 | -4 | Left | 951111865 | 3:18813228-18813250 | CCACATGAAGGGACCACGTAGAG | No data | ||
Right | 951111868 | 3:18813247-18813269 | AGAGGACAACCAAATCATCATGG | No data | ||||
951111861_951111868 | 26 | Left | 951111861 | 3:18813198-18813220 | CCAAAGAGACAAGGAGTGTGAGA | No data | ||
Right | 951111868 | 3:18813247-18813269 | AGAGGACAACCAAATCATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
951111868 | Original CRISPR | AGAGGACAACCAAATCATCA TGG | Intergenic | ||