ID: 951111869 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:18813256-18813278 |
| Sequence | TGGATTTGGCCATGATGATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 951111869_951111876 | 2 | Left | 951111869 | 3:18813256-18813278 | CCAAATCATCATGGCCAAATCCA | No data | ||
| Right | 951111876 | 3:18813281-18813303 | CCTAAGGCTCCAGACATGTAGGG | No data | ||||
| 951111869_951111878 | 15 | Left | 951111869 | 3:18813256-18813278 | CCAAATCATCATGGCCAAATCCA | No data | ||
| Right | 951111878 | 3:18813294-18813316 | ACATGTAGGGCAGCCCTCTTCGG | No data | ||||
| 951111869_951111874 | 1 | Left | 951111869 | 3:18813256-18813278 | CCAAATCATCATGGCCAAATCCA | No data | ||
| Right | 951111874 | 3:18813280-18813302 | CCCTAAGGCTCCAGACATGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 951111869 | Original CRISPR | TGGATTTGGCCATGATGATT TGG (reversed) | Intergenic | ||