ID: 951111870

View in Genome Browser
Species Human (GRCh38)
Location 3:18813265-18813287
Sequence CATGGCCAAATCCAGCCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951111867_951111870 1 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111870 3:18813265-18813287 CATGGCCAAATCCAGCCCTAAGG No data
951111865_951111870 14 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111870 3:18813265-18813287 CATGGCCAAATCCAGCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951111870 Original CRISPR CATGGCCAAATCCAGCCCTA AGG Intergenic