ID: 951111874

View in Genome Browser
Species Human (GRCh38)
Location 3:18813280-18813302
Sequence CCCTAAGGCTCCAGACATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951111869_951111874 1 Left 951111869 3:18813256-18813278 CCAAATCATCATGGCCAAATCCA No data
Right 951111874 3:18813280-18813302 CCCTAAGGCTCCAGACATGTAGG No data
951111865_951111874 29 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111874 3:18813280-18813302 CCCTAAGGCTCCAGACATGTAGG No data
951111867_951111874 16 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111874 3:18813280-18813302 CCCTAAGGCTCCAGACATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951111874 Original CRISPR CCCTAAGGCTCCAGACATGT AGG Intergenic